BME103:T930 Group 16
From OpenWetWare
(→Results) |
Current revision (14:22, 15 November 2012) (view source) (→Protocols) |
||
| (13 intermediate revisions not shown.) | |||
| Line 34: | Line 34: | ||
'''Test Run''' | '''Test Run''' | ||
| - | We first tested open PCR on October 18, 2012. We learned how to take accurate temperatures using the open PCR machine. | + | We first tested open PCR on machine 8 on October 18, 2012. We learned how to take accurate temperatures using the open PCR machine. Along with seeing how disconnecting some parts from the system would affect the PCR machine. By using open PCR we were able to make a polymerase chain reaction. In order for this to occur, open PCR had to send the DNA through different sets of temperatures to heat it up, causing the strands seperate and expose the bases. Then it cooled down the primers and combined it to the sequences. Then it was heated back up to attain an extension of the copy of the new DNA. Which was conducted in an hour and thirty minutes. The sample DNA was then used to test which patients had cancer. <br> |
| Line 47: | Line 47: | ||
'''Sample Procedures'''<br> | '''Sample Procedures'''<br> | ||
| - | To use the PCR machine we first obtained two patient DNA samples. Then we labeled eight test tubes with the patient number (three test tubes were labeled with patient one and the three others were labeled for patient two's DNA) and the last two were labeled as our positive or negative control. Once the tubes were labeled, we transferred the DNA using pipettes into the corresponding tube that contained solution which would allow the DNA to be copied. This solution was a mixture of Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. The Taq DNA polymerase is an enzyme that helps | + | To use the PCR machine we first obtained two patient DNA samples. Then we labeled eight test tubes with the patient number (three test tubes were labeled with patient one and the three others were labeled for patient two's DNA) and the last two were labeled as our positive or negative control. Once the tubes were labeled, we transferred the DNA using pipettes into the corresponding tube that contained the solution which would allow the DNA to be copied. This solution was a mixture of Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. The Taq DNA polymerase is an enzyme that helps catalyze the matching of the dNTP's (or floating nucleotides) to make copies of the original DNA strand; the MgCl2 helps the Taq be more efficient. After the samples and controls were prepared, we placed the tubes in the open PCR machine and set the correct cycles and temperatures for the DNA to copied. This process took about an hour and a half to complete. Our samples were then collected and incubated until we received them again about two weeks later. <br> |
| + | |||
| + | '''Components of Master Mix'''<br> | ||
| + | |||
| + | *2X 25μl of GoTaq® Colorless Master Mix | ||
| + | *1–5μl of DNA template | ||
| + | *50μl Nuclease-Free Water | ||
| + | *10μM of upstream primer | ||
| + | *10μM of downstream primer | ||
'''Fluorimeter Procedures''' <br> | '''Fluorimeter Procedures''' <br> | ||
| Line 57: | Line 65: | ||
4. Next align the light so that it hits the sample <br> | 4. Next align the light so that it hits the sample <br> | ||
5. Place the sample under the the black box <br> | 5. Place the sample under the the black box <br> | ||
| - | 6. Take | + | 6. Take a picture using a smart phone <br> |
7. Recorded whether or not it was able to glow <br> | 7. Recorded whether or not it was able to glow <br> | ||
8. Remove the liquid from the slide and discard it along with the pipette <br> | 8. Remove the liquid from the slide and discard it along with the pipette <br> | ||
| Line 71: | Line 79: | ||
5. The image was found in the search box where it was ready to be analyzed. | 5. The image was found in the search box where it was ready to be analyzed. | ||
| - | {| | + | |
| - | | | + | {| {{table}} |
| - | + | |- style="background:#f0f0f0;" | |
| + | | '''Reagent''' || '''Volume''' | ||
|- | |- | ||
| Template DNA (20ng) || 0.2 μL | | Template DNA (20ng) || 0.2 μL | ||
| Line 87: | Line 96: | ||
| '''Total Volume'''|| 100.0 μL | | '''Total Volume'''|| 100.0 μL | ||
|} | |} | ||
| + | |||
Here is the patient information: | Here is the patient information: | ||
| - | Patient 1 ID Number: | + | Patient 1 ID Number: 25654 |
| - | + | *Female | |
| - | + | *65 Years | |
| - | Patient 2 ID Number: | + | Patient 2 ID Number: 34311 |
| - | Female | + | *Female |
| - | + | *19 Years | |
'''Fluorimeter Measurements'''<br> | '''Fluorimeter Measurements'''<br> | ||
| Line 123: | Line 133: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
| - | A Polymerase chain reaction is a machine that amplifies a single or a few strands of DNA to generate millions of copies of that DNA sequence. Using this technology scientists can determine whether a patient has a positive or negative result towards cancer. A method of getting this data is called the PCR detection method, | + | A Polymerase chain reaction is a machine that amplifies a single or a few strands of DNA to generate millions of copies of that DNA sequence. Using this technology scientists can determine whether a patient has a positive or negative result towards cancer. A method of getting this data is called the PCR detection method, that relies on thermal cycling, switching back and forth to melt DNA and then connect primers. The PCR is used to detect whether a patient has positive result for cancer, because a sample of DNA can be taken and whether that connects to the primers and creates a chain reaction, scientists can then determine whether this DNA is positive or negative towards cancer. An example of proving this method can be seen using the r17879961 SNP, a cancer-associated sequence, using the PCR detection method we can prove that r17879961 SNP is actually associated with cancer. Because it carries with the Polymerase chain reaction, and to further prove the patient has a positive result for sample, we used fluorescent dye and if the DNA glowed in the solution, then the results were positive for cancer. |
Thermal cycling takes place in three distinct steps based on temperature. | Thermal cycling takes place in three distinct steps based on temperature. | ||
At 95° Celsius, the DNA unzips and melts into two one-stranded strips. Several primers are then added to the solution | At 95° Celsius, the DNA unzips and melts into two one-stranded strips. Several primers are then added to the solution | ||
| Line 131: | Line 141: | ||
The r17879961 sequence has a possible nucleotide alteration that is cancer associated. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found on the bottom strand of DNA and so the bottom strand is considered the template DNA. For this specific cancer-associated sequence, the bottom primer is AACTCTTACACTGCATACAT and the top primer is TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA when there is a matching genetic code. | The r17879961 sequence has a possible nucleotide alteration that is cancer associated. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found on the bottom strand of DNA and so the bottom strand is considered the template DNA. For this specific cancer-associated sequence, the bottom primer is AACTCTTACACTGCATACAT and the top primer is TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA when there is a matching genetic code. | ||
| - | Bayes Rule of Probability can be used to achieve total accuracy of the DNA amplification. Bayes Rule can be used to explain the probability of getting a false positive as well as a real positive, as well as seeing the probability of receiving a false negative/positive. This would give an extremely useful statistic | + | Bayes Rule of Probability can be used to achieve total accuracy of the DNA amplification. Bayes Rule can be used to explain the probability of getting a false positive as well as a real positive, as well as seeing the probability of receiving a false negative/positive. This would give an extremely useful statistic as to how reliable the procedure is to detect the presence of cancer genes. Based on conditional probabilities from a tested sample of 180 people from Finland, it was found that the frequency of the appearance of this cancerous gene was 7.8 %. Approximately 1.1% of people have this C/T variation sequence, hence, T/T was found to be 98.9%. |
[[Image:PCR Pic 1.jpg]]<br> | [[Image:PCR Pic 1.jpg]]<br> | ||
| - | [[Image: | + | [[Image:pcrsteps.jpg]]<br> |
| + | |||
| + | |||
| + | This photo also illustrates how Taq might be useful. In step 1 DNA is breaking apart and forming, step 2 DNA is completely melted. Step 3 extension is were Taq would come in and complete the following DNA sequence with the floating dNTP’s. | ||
| + | |||
| + | |||
| + | [[Image:threestep.jpg]]<br> | ||
| + | |||
| - | + | The denature stage is illustrating DNA breaking apart, the anneal shows the dNTP’s forming with the DNA sequence, and the extend shows Taq filling in the space in between, using the floating dNTP’s. | |
| + | Sources: | ||
| + | *"CGDP - DNA Amplification, Part 1." CGDP - DNA Amplification, Part 1. N.p., n.d. Web. 08 Nov. 2012. <http://www.flmnh.ufl.edu/cowries/amplify.html>. | ||
| + | *"Principle of the PCR." Principle of the PCR. N.p., n.d. Web. 08 Nov. 2012. <http://users.ugent.be/~avierstr/principles/pcr.html>. | ||
| + | *"Real-Time PCR:." Real Time PCR. N.p., n.d. Web. 08 Nov. 2012. <http://www.bio.davidson.edu/Courses/Molbio/Molstudents/spring2003/Pierce/realtimepcr.htm>. | ||
<br><br> | <br><br> | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Group 16LAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections When the heat sink is unplugged from the circuit board, the LCD screen is turned off. When we unplugged the white wire that connected the circuit board to the heating block the temperature reading on the LCD screen dropped drastically. Test Run We first tested open PCR on machine 8 on October 18, 2012. We learned how to take accurate temperatures using the open PCR machine. Along with seeing how disconnecting some parts from the system would affect the PCR machine. By using open PCR we were able to make a polymerase chain reaction. In order for this to occur, open PCR had to send the DNA through different sets of temperatures to heat it up, causing the strands seperate and expose the bases. Then it cooled down the primers and combined it to the sequences. Then it was heated back up to attain an extension of the copy of the new DNA. Which was conducted in an hour and thirty minutes. The sample DNA was then used to test which patients had cancer.
ProtocolsPolymerase Chain Reaction Sample Procedures To use the PCR machine we first obtained two patient DNA samples. Then we labeled eight test tubes with the patient number (three test tubes were labeled with patient one and the three others were labeled for patient two's DNA) and the last two were labeled as our positive or negative control. Once the tubes were labeled, we transferred the DNA using pipettes into the corresponding tube that contained the solution which would allow the DNA to be copied. This solution was a mixture of Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. The Taq DNA polymerase is an enzyme that helps catalyze the matching of the dNTP's (or floating nucleotides) to make copies of the original DNA strand; the MgCl2 helps the Taq be more efficient. After the samples and controls were prepared, we placed the tubes in the open PCR machine and set the correct cycles and temperatures for the DNA to copied. This process took about an hour and a half to complete. Our samples were then collected and incubated until we received them again about two weeks later. Components of Master Mix
Fluorimeter Procedures Next we began analyzing the samples by creating another solution that would allow positive samples for cancer to glow. ImageJ Procedures 1. A picture of the fluorimeter assembly was taken with a smartphone
Patient 1 ID Number: 25654
Patient 2 ID Number: 34311
Fluorimeter Measurements
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology A Polymerase chain reaction is a machine that amplifies a single or a few strands of DNA to generate millions of copies of that DNA sequence. Using this technology scientists can determine whether a patient has a positive or negative result towards cancer. A method of getting this data is called the PCR detection method, that relies on thermal cycling, switching back and forth to melt DNA and then connect primers. The PCR is used to detect whether a patient has positive result for cancer, because a sample of DNA can be taken and whether that connects to the primers and creates a chain reaction, scientists can then determine whether this DNA is positive or negative towards cancer. An example of proving this method can be seen using the r17879961 SNP, a cancer-associated sequence, using the PCR detection method we can prove that r17879961 SNP is actually associated with cancer. Because it carries with the Polymerase chain reaction, and to further prove the patient has a positive result for sample, we used fluorescent dye and if the DNA glowed in the solution, then the results were positive for cancer. Thermal cycling takes place in three distinct steps based on temperature. At 95° Celsius, the DNA unzips and melts into two one-stranded strips. Several primers are then added to the solution At 57°Celsius, the primers are joined to the complementing template sequence to then form one forward primer and one reverse primer. At 72° Celsius, the Taq Polymerase enzyme finishes the replication process through the assistance of the dNTP's and MgCl2 The r17879961 sequence has a possible nucleotide alteration that is cancer associated. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found on the bottom strand of DNA and so the bottom strand is considered the template DNA. For this specific cancer-associated sequence, the bottom primer is AACTCTTACACTGCATACAT and the top primer is TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA when there is a matching genetic code. Bayes Rule of Probability can be used to achieve total accuracy of the DNA amplification. Bayes Rule can be used to explain the probability of getting a false positive as well as a real positive, as well as seeing the probability of receiving a false negative/positive. This would give an extremely useful statistic as to how reliable the procedure is to detect the presence of cancer genes. Based on conditional probabilities from a tested sample of 180 people from Finland, it was found that the frequency of the appearance of this cancerous gene was 7.8 %. Approximately 1.1% of people have this C/T variation sequence, hence, T/T was found to be 98.9%.
Sources:
Results
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||







