BME103:T930 Group 16: Difference between revisions
Line 91: | Line 91: | ||
Patient 1 ID Number: 92136 | Patient 1 ID Number: 92136 | ||
Male | Male | ||
54 Years | 54 Years | ||
Patient 2 ID Number: 62276 | Patient 2 ID Number: 62276 | ||
Female | Female | ||
61 Years | 61 Years | ||
Revision as of 23:42, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Group 16LAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections When the heat sink is unplugged from the circuit board, the LCD screen is turned off. When we unplugged the white wire that connected the circuit board to the heating block the temperature reading on the LCD screen dropped drastically. Test Run We first tested open PCR on October 18, 2012. We learned how to take accurate temperatures using the open PCR machine. Using open PCR we were able to make a polymerase chain reaction. In order for this to occur, open PCR had to send the DNA through different sets of temperatures to heat it up to separate the strands and expose the bases, then cool it down for the primers to bind to the sequences, and also heat it back up to attain an extension of the copy of the new DNA. Which was conducted in an hour and thirty minutes.
ProtocolsPolymerase Chain Reaction Sample Procedures To use the PCR machine we first obtained two patient DNA samples. Then we labeled eight test tubes with the patient number (three test tubes were labeled with patient one and the three others were labeled for patient two's DNA) and the last two were labeled as our positive or negative control. Once the tubes were labeled, we transferred the DNA using pipettes into the corresponding tube that contained solution which would allow the DNA to be copied. This solution was a mixture of Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. The Taq DNA polymerase is an enzyme that helps to catalyze the matching of the dNTP's (or floating nucleotides) to make copies of the original DNA strand; the MgCl2 helps the Taq be more efficient. After the samples and controls were prepared, we placed the tubes in the open PCR machine and set the correct cycles and temperatures for the DNA to copied. This process took about an hour and a half to complete. Our samples were then collected and incubated until we received them again about two weeks later. Fluorimeter Procedures Next we began analyzing the samples by creating another solution that would allow positive samples for cancer to glow. ImageJ Procedures 1. A picture of the fluorimeter assembly was taken with a smartphone
Here is the patient information: Patient 1 ID Number: 92136 Male 54 Years Patient 2 ID Number: 62276 Female 61 Years Fluorimeter Measurements
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology A Polymerase chain reaction is a machine that amplifies a single or a few strands of DNA to generate millions of copies of that DNA sequence. Using this technology scientists can determine whether a patient has a positive or negative result towards cancer. A method of getting this data is called the PCR detection method, a method that relies on thermal cycling, switching back and forth to melt DNA and then connect primers. This is a method that can be used to detect whether a patient has positive result for cancer, because a sample of DNA can be taken and whether that connects to the primers and creates a chain reaction, scientists can then determine whether this DNA is positive or negative towards cancer. An example of proving this method can be seen using the r17879961 SNP, a cancer-associated sequence, using the PCR detection method we can prove that r17879961 SNP is actually associated with cancer. Because it carries with the Polymerase chain reaction, and to further prove the patient has a positive result for cancer, we use fluorescent dye and if the DNA glows in the solution, then the results are positive for cancer. Thermal cycling takes place in three distinct steps based on temperature. At 95° Celsius, the DNA unzips and melts into two one-stranded strips. Several primers are then added to the solution At 57°Celsius, the primers are joined to the complementing template sequence to then form one forward primer and one reverse primer. At 72° Celsius, the Taq Polymerase enzyme finishes the replication process through the assistance of the dNTP's and MgCl2 The r17879961 sequence has a possible nucleotide alteration that is cancer associated. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found on the bottom strand of DNA and so the bottom strand is considered the template DNA. For this specific cancer-associated sequence, the bottom primer is AACTCTTACACTGCATACAT and the top primer is TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA when there is a matching genetic code. Bayes Rule of Probability can be used to achieve total accuracy of the DNA amplification. Bayes Rule can be used to explain the probability of getting a false positive as well as a real positive, as well as seeing the probability of receiving a false negative/positive. This would give an extremely useful statistic a to how reliable the procedure is to detect the presence of cancer genes. Pictures from: http://www.foodsafetywatch.com/public/1050.cfm
Results
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||