OUR TEAM
Name: Jake Lindquist Protocol Planner
| Name: Breanna Pratt Protocol Planner
| Name: Kirsten Jefferys Open PCR Machine Engineer
| Name: Ben Alcorn Open PCR Machine Engineer
| Name: Carlos Duarte Research and Design Scientist
| Name: Bryce DeSimmone Research and Design Scientist
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
What is Not Seen
There are surrounding, wooden sides that are parallel to the Heating Lid Bracket. They are attached to the top piece and screwed in for stability. These are not seen in the image in order to show the heated lid handle, which are the key features in this PCR redesign. These wooden sides will be, however, included in the redesigned machine.
Key Features
Our redesigned system will have the adjusting heated lid handle (the turning knob and screw) removed. As the original design is, the heated lid handle twists in order to move the mounting plate and heating plate, which are attached to each other by four screws. Instead, heating plate will be fixed at a set level that, when the heating lid is closed, it will rest on top of the solution filled PCR tubes being held in the heating block. This adjustment is being made so that the operator will not have to fiddle with adjusting the lid to fit on top of the tubes in the Open PCR machine. It is essential that the heating plate be resting on top of the PCR tubes in order to transfer and contain heat within and around the tubes. The lid can be simply opened and closed with ease without worrying about the height of the heating plate. The entire lid can still be lifted by the lip of the top wooden piece.
Instructions
The instructions for this system are the same as the original Open PCR Machine, minus the step where the heated lid handle is added.
The following link provides the original manual: Media:PCR guide.pdf
1. To create the lid casing, snap the 4 side pieces (wooden) into the top piece (also wooden), and screw the top piece to the side pieces. Two wooden pieces are the same, and the other two are different. The two different side pieces have places to screw into the other sides as well as the top piece. See images and specific instructions beginning on page 5 in the above manual.
2. Remove the adhesive backing from the lid heater and attach to the rectangular plate, making the heating plate. Images begin on page 12.
3. Attach mounting plate to the heating plate with four screws. Images are on page 14.
4. Create the heated lid bracket by screwing on the hinge. Follow up by screwing the mounting plate and heating plate into place. These are set at the fixed point to rest on the tops of future PCR tubes. Images in the manual begin on page 17.
5. Attach the heated lid bracket to the lid casing made in Step 1 by four screws tightened through the top of the lid casing. Image on page 23.
Protocols
Materials
| Supplied in the kit | Amount
|
| PCR Assembly | 1
|
| Fluorimeter | 1
|
| Hydrophobic Slides | 5
|
| Phone Stand | 1
|
| Box | 1
|
| Taq Enzyme/Primer Mix | Enough for all the samples
|
| SYBR Green | enough for all samples
|
| Supplied by User | Amount
|
| Samples | 3 samples per subject
|
| Positive & Negative controls | 1 each
|
| Calibrator (Calif.../water blank) | 1 each
|
| Test tubes | 1 for each sample, and control
|
| Pippettes | 1 for each sample, control, and calibration solution
|
| Smart Phone with camera | 1
|
PCR Protocol
- Procedure:
- Preparing the DNA samples
- Obtain 6 DNA samples, 2 subjects with 3 samples from each subject and clearly label each test tube. Also include 2 extra tubes, a positive and a negative control
- Add 50 μL of the PCR reaction mixture to each 50 μL sample of patient DNA, using a new pipette tip for ever sample transfer. The PCR reaction mix is composed of:
- 0.2 μL Template DNA (20 ng)
- 1.0 μL 10 μM forward primer
- 1.0 μL 10 μM reverse primer
- 50.0 μL GoTaq master mix
- 2X Colorless GoTaq® Reaction Buffer( pH 8.5)
- 400μM dATP
- 400μM dGTP
- 400μM dCTP
- 400μM dTTP
- 3mM MgCl2.
- 47.8 μL dH2O (A total volume of 100.0 μL)
- The eight prepared samples should be placed into a refrigerator until they are placed into the Open PCR Machine.
- Setting up the Open PCR Machine
- The Open PCR Machine must be plugged in and connected to a computer through a USB port and cable.
- The PCR machine holds 16 samples, only 8 of the wells will be used in this situation. Place the wells horizontally to the lid hinge, in the inner well rows.
- Close the lid and ensure that it snaps down completely
- Once the machine is turned on and plugged into the computer, with software already downloaded, the test should be programed as follows
- 30 cycles must be run of the following pattern
- 90ºC for 30 seconds
- 57ºC for 30 seconds
- 72ºC for 30 seconds
- The reaction will run its course in 1-2 hours during which period the machine should be monitored as it can get extremely hot.
- After a few minutes the DNA samples should be removed from the machine and placed into the refrigerator until they are going to be analysed.
DNA Measurement Protocol
DNA Sample Preparation
- Obtain all the DNA samples run through the Open PCR machine along with calf thymus DNA and a water sample.
- Take the provided Eppendorf tubes with 400 mL of buffer solution and label them in conjuction with labeling pipettes. Maintain constant labels to avoid contamination.
- Transfer each DNA sample, positive control, negative control, and calf thymus DNA into a separate eppendorf tube with its labeled pipette. This does not need to be done with water.
Fluorimeter Setup
- Obtain a box of materials including: Fluorimeter, phone stand, hydrophobic slides, pipettes, Sybr Green, and the 9 eppendorf tubes prepared earlier.
- The hydrophobic slide (polymer side up) should be placed onto the LED box with the first two rows of nodes centered with the LED light.
- For each sample two drops of the Sybr Green Dye are added to the center nodes of the slide. That is, in the first two horizontal rows with the two central dots of each connecting. One drop for each node, or until the two drops coalesce.
- Two drops of the subjects DNA mixture (or positive/negative control or Calf Thymus DNA or water sample as appropriate) solution were added to the dye.
- Turn on the LED on and the phone;s camera should be centered onto the drop, held up by the stand.
- The dark box was placed over the whole setup and closed as completely as possible.
- A picture was taken and sent to the ImageJ program to be analyzed through an email to the software operators.
- The drop was removed and disposed of and the slide was re centered on the next two nodes.
- The whole procedure was repeated for each sample with the phone in the same place in relation to the drop throughout the entire experiement.
ImageJ Analysis
- Attach the image to an E-mail to be sent from the smart phone to the ImageJ Software Operator.
- Once the operator has received the image they will save the image to a computer with ImageJ software, opening the image to be analyzed.
- In the ImageJ software open the analyze toolbar and mark the following boxes under Set Measurements:
- Area
- Mean Grey Area Value
- Integrated Density
- Once the image is opened in ImageJ use the top drop down menu to select "Image" and then "Color" and then "Split Screen"
- Only use the green channel, closing out the red and blue channels of the image
- Use the oval tool to select only the drop of liquid, getting as little background as possible while not cutting any of the drop out.
- After selecting only the drop press Ctrl+M to find the density of the image
- Move the circle to the background image without changing the size by clicking and dragging the circle and press Ctrl+M again to take the density of the background, meaning density that should not be counted in the original image
- Repeat this procedure for all images, including the controls, calibration and water sample
- Finally, save the results as an excel spreadsheet through the ImageJ software (set by default)
Research and Development
Background on Disease Markers
ALZHEIMER'S DISEASE (AD)
As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful
amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors.
Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)
HUNTINGTON'S DISEASE (HD)
Huntington's disease is caused by a genetic defect on chromosome 4, causing a part of DNA called CAG to occur more than it is supposed to.People with Huntington's disease have 36 to 120 repeats of this section of DNA, when normally it is only repeated about 10 to 28 times. Huntington's disease is passed down through generations in which nerve cells in certain parts of the brain waste away or degenerate. In people with Huntington's disease this section of DNA is repeated 36 to 120 times, when normally it is only repeated about 10 to 28 times. Unfortunately, as the gene is passed down in families, the number of repeats tends to grow, and along with this so do the chances of developing the symptoms at an earlier age. This means that as the disease is passed down generations of families, symptoms develop at a younger ages. The common form of Huntington's disease is the adult-onset form. People with this form develop the symptoms in their mid 30s and 40s. The other form is the early-onset form, however it only accounts for a small number of cases and it begins in childhood or adolescence. The chances of getting the gene for HD if only one of your parents has it is 50%. If you do get the gene from your parents, then you will develop the disease at some point, and you can pass it onto your children. However, if you yourself do not get the gene from your parents then you can't pass the gene onto your children
Most of info found on: (http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001775/)
Primer Design
ALZHEIMER'S DISEASE (AD)
Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT.
Forward Primer:GACAATTGCTAAGTGAACA
Reverse Primer:ACAAGTGAATCGTTAACAG
Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.
HUNTINGTON'S DISEASE (HD)
The sequence for Huntington's Disease we decided to focus on is rs2857936, which causes an A to change to a G. The specific primer sequence that we located for this disease was GGCTGCTTTTC[A/G]TTGAAAAG. Following the DNA strand to the left, the specific primer for this type of genetic HD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is CTGCACTTGACATGATGTTC (http://www.ncbi.nlm.nih.gov/snp?term=Rs7665116), which can be used to help identify DNA with this genetic variation present. And the reverse would be ACAAGTGAATCGTTAACAG.
Forward Primer:CTGCACTTGACATGATGTTC
Reverse Primer:GACGTGAACTGTACTACAAG
Other variances of HD occur in rs3856973 and rs3856973 (which both involve a change of C to T). Again as was discussed in the previous lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. Thus, the primer will bind and replicate the DNA exponentially, resulting in a positive. However, if the disease is not present the primer will have no chance to bind, resulting in a negative.
Illustration
|