BME103:T930 Group 14 l2

From OpenWetWare

Revision as of 00:07, 29 November 2012 by Kirsten J. Jefferys (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Jake LindquistProtocol Planner
Name: Jake Lindquist
Protocol Planner
Name: Breanna PrattProtocol Planner
Name: Breanna Pratt
Protocol Planner
Name: Kirsten JefferysOpen PCR Machine Engineer
Name: Kirsten Jefferys
Open PCR Machine Engineer
Name: Ben AlcornOpen PCR Machine Engineer
Name: Ben Alcorn
Open PCR Machine Engineer
Name: Carlos DuarteResearch and Design Scientist
Name: Carlos Duarte
Research and Design Scientist
Name: Bryce DeSimmoneResearch and Design Scientist
Name: Bryce DeSimmone
Research and Design Scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

Description of image


What is Not Seen
There are surrounding, wooden sides that are parallel to the Heating Lid Bracket. They are attached to the top piece and screwed in for stability. These are not seen in the image in order to show the turning knob and screw, which are the key features in this PCR redesign.


Key Features
Our redesigned system will have the adjusting heated lid handle (the turning knob and screw) removed. As the original design is, the heated lid handle twists in order to move the mounting plate and heating plate, which are attached to each other by four screws. Instead, heating plate will be fixed at a set level that, when the heating lid is closed, the heating plate will rest on top of the solution filled PCR tubes being held in the heating block. This adjustment is being made so that the operator will not have to fiddle with adjusting the lid to fit on top of the tubes in the Open PCR machine. The lid can be simply opened and closed with ease without worrying about the height of the heating plate.


Instructions
The instructions for this system are the same as the old system, minus having to adjust the height of the heating plate.




Protocols

Materials

Supplied in the kit Amount
PCR Assembly 1
Fluorimeter 1
Hydrophobic Slides 5
Phone Stand 1
Box 1
Taq Enzyme/Primer Mix Enough for all the samples
SYBR Green enough for all samples


Supplied by User Amount
Samples 3 samples per subject
Positive & Negative controls 1 each
Calibrator (Calif.../water blank) 1 each
Test tubes 1 for each sample, and control
Pippettes 1 for each sample, control, and calibration solution
Smart Phone with camera 1


PCR Protocol

  • Procedure:
    • Preparing the DNA samples
  1. Obtain 6 DNA samples, 2 subjects with 3 samples from each subject and clearly label each test tube. Also include 2 extra tubes, a positive and a negative control
  2. Add 50 μL of the PCR reaction mixture to each 50 μL sample of patient DNA, using a new pipette tip for ever sample transfer. The PCR reaction mix is composed of:
    1. 0.2 μL Template DNA (20 ng)
    2. 1.0 μL 10 μM forward primer
    3. 1.0 μL 10 μM reverse primer
    4. 50.0 μL GoTaq master mix
      1. 2X Colorless GoTaq® Reaction Buffer( pH 8.5)
      2. 400μM dATP
      3. 400μM dGTP
      4. 400μM dCTP
      5. 400μM dTTP
      6. 3mM MgCl2.
    5. 47.8 μL dH2O (A total volume of 100.0 μL)
  3. The eight prepared samples should be placed into a refrigerator until they are placed into the Open PCR Machine.
    • Setting up the Open PCR Machine
  1. The Open PCR Machine must be plugged in and connected to a computer through a USB port and cable.
  2. The PCR machine holds 16 samples, only 8 of the wells will be used in this situation. Place the wells horizontally to the lid hinge, in the inner well rows.
  3. Close the lid and ensure that it snaps down completely
  4. Once the machine is turned on and plugged into the computer, with software already downloaded, the test should be programed as follows
    1. 30 cycles must be run of the following pattern
      1. 90ºC for 30 seconds
      2. 57ºC for 30 seconds
      3. 72ºC for 30 seconds
  5. The reaction will run its course in 1-2 hours during which period the machine should be monitored as it can get extremely hot.
  6. After a few minutes the DNA samples should be removed from the machine and placed into the refrigerator until they are going to be analysed.

DNA Measurement Protocol DNA Sample Preparation

  1. Obtain all the DNA samples run through the Open PCR machine along with calf thymus DNA and a water sample.
  2. Take the provided Eppendorf tubes with 400 mL of buffer solution and label them in conjuction with labeling pipettes. Maintain constant labels to avoid contamination.
  3. Transfer each DNA sample, positive control, negative control, and calf thymus DNA into a separate eppendorf tube with its labeled pipette. This does not need to be done with water.

Fluorimeter Setup

  • Procedure:
  1. Obtain a box of materials including: Fluorimeter, phone stand, hydrophobic slides, pipettes, Sybr Green, and the 9 eppendorf tubes prepared earlier.
  2. The hydrophobic slide (polymer side up) should be placed onto the LED box with the first two rows of nodes centered with the LED light.
  3. For each sample two drops of the Sybr Green Dye are added to the center nodes of the slide. That is, in the first two horizontal rows with the two central dots of each connecting. One drop for each node, or until the two drops coalesce.
  4. Two drops of the subjects DNA mixture (or positive/negative control or Calf Thymus DNA or water sample as appropriate) solution were added to the dye.
  5. The LED was turned on and the phone camera was centered onto the drop, held up by the stand.
  6. The dark box was placed over the whole setup and closed as completely as possible.
  7. A picture was taken and sent to the ImageJ program to be analyzed.
  8. The drop was removed and disposed of and the slide was re centered on the next two nodes.
  9. The whole procedure was repeated for each sample with the phone in the same place in relation to the drop throughout the entire procedure.

Research and Development

Background on Disease Markers

ALZHEIMER'S DISEASE (AD)

As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors.

Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)


Primer Design

ALZHEIMER'S DISEASE (AD)

Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT.

Forward Primer:GACAATTGCTAAGTGAACA Reverse Primer:ACAAGTGAATCGTTAACAG

Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.


Illustration


Personal tools