BME103:T930 Group 14 l2

From OpenWetWare

Revision as of 23:52, 28 November 2012 by Benjamin R. Alcorn (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Jake LindquistProtocol Planner
Name: Jake Lindquist
Protocol Planner
Name: Breanna PrattProtocol Planner
Name: Breanna Pratt
Protocol Planner
Name: Kirsten JefferysOpen PCR Machine Engineer
Name: Kirsten Jefferys
Open PCR Machine Engineer
Name: Ben AlcornOpen PCR Machine Engineer
Name: Ben Alcorn
Open PCR Machine Engineer
Name: Carlos DuarteResearch and Design Scientist
Name: Carlos Duarte
Research and Design Scientist
Name: Bryce DeSimmoneResearch and Design Scientist
Name: Bryce DeSimmone
Research and Design Scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design

What changes are we making to our system?

Key Features


Instructions





Protocols

Materials

Supplied in the kit Amount
PCR Assembly 1
Fluorimeter 1
Phone Stand 1
Box 1


Supplied by User Amount
Samples 3 samples per subject
Positive & Negative controls 1 each
Calibrator (Calif.../water blank) 1 each
Enzyme/Primer mix Enough for all the samples
Test tubes 1 for each sample, and control
Pippettes 1 for each sample, control, and calibration solution


PCR Protocol

  • Procedure:
  1. Obtain 6 DNA samples, 2 subjects with 3 samples from each subject and clearly label each test tube. Also include 2 extra tubes, a positive and a negative control
  2. Add 50 μL of the PCR reaction mixture to each 50 μL sample of patient DNA. The PCR reaction mix is composed of:
    1. 0.2 μL Template DNA (20 ng)
    2. 1.0 μL 10 μM forward primer
    3. 1.0 μL 10 μM reverse primer
    4. 50.0 μL GoTaq master mix
      1. 2X Colorless GoTaq® Reaction Buffer( pH 8.5)
      2. 400μM dATP
      3. 400μM dGTP
      4. 400μM dCTP
      5. 400μM dTTP
      6. 3mM MgCl2.
    5. 47.8 μL dH2O (A total volume of 100.0 μL)
  3. The eight prepared samples were placed into the PCR Machine, the lid must be screwed down until it rests on the test tubes.
  4. The PCR was run with a program of 30 cycles of the following steps:
    1. 90ºC for 30 seconds
    2. 57ºC for 30 seconds
    3. 72ºC for 30 seconds.


DNA Measurement Protocol

Research and Development

Background on Disease Markers

ALZHEIMER'S DISEASE (AD)

As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors.

Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)


Primer Design

ALZHEIMER'S DISEASE (AD)

Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT.

Forward Primer:GACAATTGCTAAGTGAACA Reverse Primer:ACAAGTGAATCGTTAACAG

Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.


Illustration


Personal tools