OUR TEAM
Name: Jake Lindquist Protocol Planner
| Name: Breanna Pratt Protocol Planner
| Name: Kirsten Jefferys Open PCR Machine Engineer
| Name: Ben Alcorn Open PCR Machine Engineer
| Name: Carlos Duarte Research and Design Scientist
| Name: Bryce DeSimmone Research and Design Scientist
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
Key Features
Instructions
Protocols
Materials
| Supplied in the kit | Amount
|
| PCR Assembly | 1
|
| Fluorimeter | 1
|
| Phone Stand | 1
|
| Box | 1
|
| Supplied by User | Amount
|
| Samples | 3 samples per subject
|
| Positive & Negative controls | 1 each
|
| Calibrator (Calif.../water blank) | 1 each
|
| Enzyme/Primer mix | Enough for all the samples
|
| Test tubes | 1 for each sample, and control
|
| Pippettes | 1 for each sample, control, and calibration solution
|
PCR Protocol
DNA Measurement Protocol
Research and Development
Background on Disease Markers
As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful
amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors.
Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)
Primer Design
Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621.
Illustration
|