BME103:T930 Group 14 l2 - Revision history

Carlos F. Duarte: /* Research and Development */

Carlos F. Duarte — Thu, 29 Nov 2012 18:10:57 GMT

Research and Development

←Older revision		Revision as of 18:10, 29 November 2012
Line 227:		Line 227:
	<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->		<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->

-	~~ALZHEIMER'S DISEASE~~	+
	[[Image:Alzheimer's Unamplified DNA.jpg]]		[[Image:Alzheimer's Unamplified DNA.jpg]]
	[[Image:Alzheimer's Denaturing DNA.jpg]]		[[Image:Alzheimer's Denaturing DNA.jpg]]
Line 233:		Line 233:
	[[Image:Alzheimer's Extension DNA.jpg]]		[[Image:Alzheimer's Extension DNA.jpg]]

-	~~HUNTINGTON'S DISEASE~~
	[[Image:Huntington's Unamplified DNA.jpg]]		[[Image:Huntington's Unamplified DNA.jpg]]
	[[Image:Huntington's Denaturing DNA.jpg]]		[[Image:Huntington's Denaturing DNA.jpg]]

Carlos F. Duarte: /* Research and Development */

Carlos F. Duarte — Thu, 29 Nov 2012 18:06:45 GMT

Research and Development

←Older revision		Revision as of 18:06, 29 November 2012
Line 226:		Line 226:

	<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->		<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
		+
		+	ALZHEIMER'S DISEASE
	[[Image:Alzheimer's Unamplified DNA.jpg]]		[[Image:Alzheimer's Unamplified DNA.jpg]]
	[[Image:Alzheimer's Denaturing DNA.jpg]]		[[Image:Alzheimer's Denaturing DNA.jpg]]
Line 231:		Line 233:
	[[Image:Alzheimer's Extension DNA.jpg]]		[[Image:Alzheimer's Extension DNA.jpg]]

		+	HUNTINGTON'S DISEASE
	[[Image:Huntington's Unamplified DNA.jpg]]		[[Image:Huntington's Unamplified DNA.jpg]]
	[[Image:Huntington's Denaturing DNA.jpg]]		[[Image:Huntington's Denaturing DNA.jpg]]

Carlos F. Duarte: /* Research and Development */

Carlos F. Duarte — Thu, 29 Nov 2012 18:00:37 GMT

Research and Development

←Older revision		Revision as of 18:00, 29 November 2012
Line 227:		Line 227:
	<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->		<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
	[[Image:Alzheimer's Unamplified DNA.jpg]]		[[Image:Alzheimer's Unamplified DNA.jpg]]
		+	[[Image:Alzheimer's Denaturing DNA.jpg]]
		+	[[Image:Alzheimer's Annealing DNA.jpg]]
		+	[[Image:Alzheimer's Extension DNA.jpg]]
		+
		+	[[Image:Huntington's Unamplified DNA.jpg]]
		+	[[Image:Huntington's Denaturing DNA.jpg]]
		+	[[Image:Huntington's Annealing DNA.jpg]]
		+	[[Image:Huntington's Extension DNA.jpg]]

	<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->		<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
	\|}		\|}

Carlos F. Duarte: /* Research and Development */

Carlos F. Duarte — Thu, 29 Nov 2012 17:34:52 GMT

Research and Development

←Older revision		Revision as of 17:34, 29 November 2012
Line 226:		Line 226:

	<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->		<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
-	[[Image:Alzheimer's Unamplified DNA]]	+	[[Image:Alzheimer's Unamplified DNA.jpg]]

	<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->		<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
	\|}		\|}

Carlos F. Duarte: /* Research and Development */

Carlos F. Duarte — Thu, 29 Nov 2012 17:29:02 GMT

Research and Development

←Older revision		Revision as of 17:29, 29 November 2012
Line 226:		Line 226:

	<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->		<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
-		+	[[Image:Alzheimer's Unamplified DNA]]

	<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->		<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
	\|}		\|}

Carlos F. Duarte: /* Research and Development */

Carlos F. Duarte — Thu, 29 Nov 2012 16:35:53 GMT

Research and Development

←Older revision		Revision as of 16:35, 29 November 2012
Line 214:		Line 214:
	HUNTINGTON'S DISEASE (HD)		HUNTINGTON'S DISEASE (HD)

-	The sequence for Huntington's Disease we decided to focus on is rs2857936, which causes an A to change to a G. The specific primer sequence that we located for this disease was GGCTGCTTTTC[A/G]TTGAAAAG.	+	The sequence for Huntington's Disease we decided to focus on is rs2857936, which causes an A to change to a G. The specific primer sequence that we located for this disease was GGCTGCTTTTC[A/G]TTGAAAAG. Following the DNA strand to the left, the specific primer for this type of genetic HD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is CTGCACTTGACATGATGTTC (http://www.ncbi.nlm.nih.gov/snp?term=Rs7665116), which can be used to help identify DNA with this genetic variation present. And the reverse would be ACAAGTGAATCGTTAACAG.



-	/Following the DNA strand to the left, the specific primer for this type of genetic HD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is ......., which can be used to help identify DNA with this genetic variation present. And the reverse would be ......./	+	Forward Primer:CTGCACTTGACATGATGTTC
-		+	Reverse Primer:GACGTGAACTGTACTACAAG
-		+
-		+
-	Forward Primer:	+
-	Reverse Primer:	+

	Other variances of HD occur in rs3856973 and rs3856973 (which both involve a change of C to T). Again as was discussed in the previous lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. Thus, the primer will bind and replicate the DNA exponentially, resulting in a positive. However, if the disease is not present the primer will have no chance to bind, resulting in a negative.		Other variances of HD occur in rs3856973 and rs3856973 (which both involve a change of C to T). Again as was discussed in the previous lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. Thus, the primer will bind and replicate the DNA exponentially, resulting in a positive. However, if the disease is not present the primer will have no chance to bind, resulting in a negative.

Carlos F. Duarte: /* Research and Development */

Carlos F. Duarte — Thu, 29 Nov 2012 16:01:51 GMT

Research and Development

←Older revision		Revision as of 16:01, 29 November 2012
Line 193:		Line 193:
	Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)		Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)

		+	HUNTINGTON'S DISEASE (HD)

		+	Huntington's disease is caused by a genetic defect on chromosome 4, causing a part of DNA called CAG to occur more than it is supposed to.People with Huntington's disease have 36 to 120 repeats of this section of DNA, when normally it is only repeated about 10 to 28 times. Huntington's disease is passed down through generations in which nerve cells in certain parts of the brain waste away or degenerate. In people with Huntington's disease this section of DNA is repeated 36 to 120 times, when normally it is only repeated about 10 to 28 times. Unfortunately, as the gene is passed down in families, the number of repeats tends to grow, and along with this so do the chances of developing the symptoms at an earlier age. This means that as the disease is passed down generations of families, symptoms develop at a younger ages. The common form of Huntington's disease is the adult-onset form. People with this form develop the symptoms in their mid 30s and 40s. The other form is the early-onset form, however it only accounts for a small number of cases and it begins in childhood or adolescence. The chances of getting the gene for HD if only one of your parents has it is 50%. If you do get the gene from your parents, then you will develop the disease at some point, and you can pass it onto your children. However, if you yourself do not get the gene from your parents then you can't pass the gene onto your children
		+
		+	Most of info found on: (http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001775/)

	'''Primer Design'''		'''Primer Design'''
Line 207:		Line 211:
	Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.		Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.

		+
		+	HUNTINGTON'S DISEASE (HD)
		+
		+	The sequence for Huntington's Disease we decided to focus on is rs2857936, which causes an A to change to a G. The specific primer sequence that we located for this disease was GGCTGCTTTTC[A/G]TTGAAAAG.
		+
		+
		+
		+	/Following the DNA strand to the left, the specific primer for this type of genetic HD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is ......., which can be used to help identify DNA with this genetic variation present. And the reverse would be ......./
		+
		+
		+
		+	Forward Primer:
		+	Reverse Primer:
		+
		+	Other variances of HD occur in rs3856973 and rs3856973 (which both involve a change of C to T). Again as was discussed in the previous lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. Thus, the primer will bind and replicate the DNA exponentially, resulting in a positive. However, if the disease is not present the primer will have no chance to bind, resulting in a negative.

	'''Illustration'''		'''Illustration'''

Kirsten J. Jefferys: /* Thermal Cycler Engineering */

Kirsten J. Jefferys — Thu, 29 Nov 2012 05:59:10 GMT

Thermal Cycler Engineering

←Older revision		Revision as of 05:59, 29 November 2012
Line 51:		Line 51:
	3. Attach mounting plate to the heating plate with four screws. Images are on page 14. <br>		3. Attach mounting plate to the heating plate with four screws. Images are on page 14. <br>
	4. Create the heated lid bracket by screwing on the hinge. Follow up by screwing the mounting plate and heating plate into place. These are set at the fixed point to rest on the tops of future PCR tubes. Images in the manual begin on page 17. <br>		4. Create the heated lid bracket by screwing on the hinge. Follow up by screwing the mounting plate and heating plate into place. These are set at the fixed point to rest on the tops of future PCR tubes. Images in the manual begin on page 17. <br>
-	5. Attach the heated lid bracket to the lid casing made in Step 1 by four screws tightened through the top of the lid casing. <br>	+	5. Attach the heated lid bracket to the lid casing made in Step 1 by four screws tightened through the top of the lid casing. Image on page 23. <br>

	<!--- From Week 4 exercise --->		<!--- From Week 4 exercise --->

Kirsten J. Jefferys: /* Thermal Cycler Engineering */

Kirsten J. Jefferys — Thu, 29 Nov 2012 05:57:28 GMT

Thermal Cycler Engineering

←Older revision		Revision as of 05:57, 29 November 2012
Line 47:		Line 47:
	The following link provides the original manual: [[Media:PCR guide.pdf]]		The following link provides the original manual: [[Media:PCR guide.pdf]]

-	1. ~~Snap~~ the 4 side pieces (wooden) into the top piece (also wooden), and screw the top piece to the side pieces. Two wooden pieces are the same, and the other two are different. The two different side pieces have places to screw into the other sides as well as the top piece. See images and specific instructions beginning on page 5 in the above manual.	+	1. To create the lid casing, snap the 4 side pieces (wooden) into the top piece (also wooden), and screw the top piece to the side pieces. Two wooden pieces are the same, and the other two are different. The two different side pieces have places to screw into the other sides as well as the top piece. See images and specific instructions beginning on page 5 in the above manual.<br>
-	2. Remove the adhesive backing from the lid heater and attach to the rectangular plate, making the heating plate. Images begin on page 12.	+	2. Remove the adhesive backing from the lid heater and attach to the rectangular plate, making the heating plate. Images begin on page 12.<br>
-	3. Attach mounting plate to the heating plate with four screws. Images are on page 14.	+	3. Attach mounting plate to the heating plate with four screws. Images are on page 14. <br>
-	4. Create the heated lid bracket by screwing on the hinge. Follow up by screwing the mounting plate and heating plate into place. These are set at the fixed point to rest on the tops of future PCR tubes. Images in the manual begin on page 17.<br>	+	4. Create the heated lid bracket by screwing on the hinge. Follow up by screwing the mounting plate and heating plate into place. These are set at the fixed point to rest on the tops of future PCR tubes. Images in the manual begin on page 17. <br>
		+	5. Attach the heated lid bracket to the lid casing made in Step 1 by four screws tightened through the top of the lid casing. <br>

	<!--- From Week 4 exercise --->		<!--- From Week 4 exercise --->

Kirsten J. Jefferys: /* Thermal Cycler Engineering */

Kirsten J. Jefferys — Thu, 29 Nov 2012 05:54:43 GMT

Thermal Cycler Engineering

←Older revision		Revision as of 05:54, 29 November 2012
Line 48:		Line 48:

	1. Snap the 4 side pieces (wooden) into the top piece (also wooden), and screw the top piece to the side pieces. Two wooden pieces are the same, and the other two are different. The two different side pieces have places to screw into the other sides as well as the top piece. See images and specific instructions beginning on page 5 in the above manual.		1. Snap the 4 side pieces (wooden) into the top piece (also wooden), and screw the top piece to the side pieces. Two wooden pieces are the same, and the other two are different. The two different side pieces have places to screw into the other sides as well as the top piece. See images and specific instructions beginning on page 5 in the above manual.
-	2. ~~Attach~~ the lid heater to the ~~lid~~ plate, making the heating plate. Images begin on page 12.	+	2. Remove the adhesive backing from the lid heater and attach to the rectangular plate, making the heating plate. Images begin on page 12.
-	3. <br>	+	3. Attach mounting plate to the heating plate with four screws. Images are on page 14.
		+	4. Create the heated lid bracket by screwing on the hinge. Follow up by screwing the mounting plate and heating plate into place. These are set at the fixed point to rest on the tops of future PCR tubes. Images in the manual begin on page 17.<br>

	<!--- From Week 4 exercise --->		<!--- From Week 4 exercise --->