BME103:T930 Group 14 l2
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers ALZHEIMER'S DISEASE (AD) As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors. Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)
Primer Design ALZHEIMER'S DISEASE (AD) Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Forward Primer:GACAATTGCTAAGTGAACA Reverse Primer:ACAAGTGAATCGTTAACAG Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621.
|