BME103:T930 Group 14 l2: Difference between revisions
Line 153: | Line 153: | ||
# The drop was removed and disposed of and the slide was re centered on the next two nodes. | # The drop was removed and disposed of and the slide was re centered on the next two nodes. | ||
# The whole procedure was repeated for each sample with the phone in the same place in relation to the drop throughout the entire experiement. | # The whole procedure was repeated for each sample with the phone in the same place in relation to the drop throughout the entire experiement. | ||
'''ImageJ Procedure''' | |||
# Attach the image to an E-mail to be sent from the smart phone to the ImageJ Software Operator. | |||
# Once the operator has received the image they will save the image to a computer with ImageJ software, opening the image to be analyzed. | |||
# In the ImageJ software open the analyze toolbar and mark the following boxes under Set Measurements: | |||
## Area | |||
## Mean Grey Area Value | |||
## Integrated Density | |||
# Once the image is opened in ImageJ use the top drop down menu to select "Image" and then "Color" and then "Split Screen" | |||
# Only use the green channel, closing out the red and blue channels of the image | |||
# Use the oval tool to select only the drop of liquid, getting as little background as possible while not cutting any of the drop out. | |||
# After selecting only the drop press Ctrl+M to find the density of the image | |||
# Move the circle to the background image without changing the size by clicking and dragging the circle and press Ctrl+M again to take the density of the background, meaning density that should not be counted in the original image | |||
# Repeat this procedure for all images, including the controls, calibration and water sample | |||
# Finally, save the results as an excel spreadsheet through the ImageJ software (set by default) | |||
==Research and Development== | ==Research and Development== |
Revision as of 22:20, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials
DNA Measurement Protocol DNA Sample Preparation
Fluorimeter Setup
ImageJ Procedure
Research and DevelopmentBackground on Disease Markers ALZHEIMER'S DISEASE (AD) As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors. Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)
Primer Design ALZHEIMER'S DISEASE (AD) Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Forward Primer:GACAATTGCTAAGTGAACA Reverse Primer:ACAAGTGAATCGTTAACAG Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.
|