BME103:T930 Group 14 l2: Difference between revisions
(2 intermediate revisions by the same user not shown) | |||
Line 226: | Line 226: | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:Alzheimer's Unamplified DNA.jpg]] | [[Image:Alzheimer's Unamplified DNA.jpg]] | ||
[[Image:Alzheimer's Denaturing DNA.jpg]] | |||
[[Image:Alzheimer's Annealing DNA.jpg]] | |||
[[Image:Alzheimer's Extension DNA.jpg]] | |||
[[Image:Huntington's Unamplified DNA.jpg]] | |||
[[Image:Huntington's Denaturing DNA.jpg]] | |||
[[Image:Huntington's Annealing DNA.jpg]] | |||
[[Image:Huntington's Extension DNA.jpg]] | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Latest revision as of 11:10, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
The following link provides the original manual: Media:PCR guide.pdf 1. To create the lid casing, snap the 4 side pieces (wooden) into the top piece (also wooden), and screw the top piece to the side pieces. Two wooden pieces are the same, and the other two are different. The two different side pieces have places to screw into the other sides as well as the top piece. See images and specific instructions beginning on page 5 in the above manual.
ProtocolsMaterials
DNA Measurement Protocol DNA Sample Preparation
Fluorimeter Setup
ImageJ Analysis
Research and DevelopmentBackground on Disease Markers ALZHEIMER'S DISEASE (AD) As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors. Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf) HUNTINGTON'S DISEASE (HD) Huntington's disease is caused by a genetic defect on chromosome 4, causing a part of DNA called CAG to occur more than it is supposed to.People with Huntington's disease have 36 to 120 repeats of this section of DNA, when normally it is only repeated about 10 to 28 times. Huntington's disease is passed down through generations in which nerve cells in certain parts of the brain waste away or degenerate. In people with Huntington's disease this section of DNA is repeated 36 to 120 times, when normally it is only repeated about 10 to 28 times. Unfortunately, as the gene is passed down in families, the number of repeats tends to grow, and along with this so do the chances of developing the symptoms at an earlier age. This means that as the disease is passed down generations of families, symptoms develop at a younger ages. The common form of Huntington's disease is the adult-onset form. People with this form develop the symptoms in their mid 30s and 40s. The other form is the early-onset form, however it only accounts for a small number of cases and it begins in childhood or adolescence. The chances of getting the gene for HD if only one of your parents has it is 50%. If you do get the gene from your parents, then you will develop the disease at some point, and you can pass it onto your children. However, if you yourself do not get the gene from your parents then you can't pass the gene onto your children Most of info found on: (http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001775/) Primer Design ALZHEIMER'S DISEASE (AD) Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Forward Primer:GACAATTGCTAAGTGAACA Reverse Primer:ACAAGTGAATCGTTAACAG Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.
The sequence for Huntington's Disease we decided to focus on is rs2857936, which causes an A to change to a G. The specific primer sequence that we located for this disease was GGCTGCTTTTC[A/G]TTGAAAAG. Following the DNA strand to the left, the specific primer for this type of genetic HD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is CTGCACTTGACATGATGTTC (http://www.ncbi.nlm.nih.gov/snp?term=Rs7665116), which can be used to help identify DNA with this genetic variation present. And the reverse would be ACAAGTGAATCGTTAACAG.
Forward Primer:CTGCACTTGACATGATGTTC Reverse Primer:GACGTGAACTGTACTACAAG Other variances of HD occur in rs3856973 and rs3856973 (which both involve a change of C to T). Again as was discussed in the previous lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. Thus, the primer will bind and replicate the DNA exponentially, resulting in a positive. However, if the disease is not present the primer will have no chance to bind, resulting in a negative. Illustration
|