BME103:T930 Group 14 l2

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Research and Development)
Line 111: Line 111:
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->
-
jdkl
+
As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful
 +
amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors.
Line 119: Line 120:
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
-
 
+
Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621.

Revision as of 21:03, 28 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Jake LindquistProtocol Planner
Name: Jake Lindquist
Protocol Planner
Name: Breanna PrattProtocol Planner
Name: Breanna Pratt
Protocol Planner
Name: Kirsten JefferysOpen PCR Machine Engineer
Name: Kirsten Jefferys
Open PCR Machine Engineer
Name: Ben AlcornOpen PCR Machine Engineer
Name: Ben Alcorn
Open PCR Machine Engineer
Name: Carlos DuarteResearch and Design Scientist
Name: Carlos Duarte
Research and Design Scientist
Name: Bryce DeSimmoneResearch and Design Scientist
Name: Bryce DeSimmone
Research and Design Scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials

Supplied in the kit Amount
PCR Assembly 1
Fluorimeter 1
Phone Stand 1
Box 1


Supplied by User Amount
Samples 3 samples per subject
Positive & Negative controls 1 each
Calibrator (Calif.../water blank) 1 each
Enzyme/Primer mix Enough for all the samples
Test tubes 1 for each sample, and control
Pippettes 1 for each sample, control, and calibration solution


PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers

As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors.


Primer Design


Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621.


Illustration


Personal tools