THE A TEAM
Name: Marcus Sansoni Open PCR Machine Engineer
| Name: Pete Marple Open PCR Machine Engineer
| Name: Michelle Lipowicz Experimental Protocol Planner
| Name: Allen Janis R&D Scientist
| Name: Ian Bainbridge R&D Scientist
| Name: Tyler Barnes Open PCR Machine Engineer
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design The Heat Sink Fan moves air across the metal sheets to cool down the PCR machine and the samples. The Heat Sink removes heat from the PCR machine to cool down the samples. It does this by conducting heat down to the metal sheets that are located beside the heat sink fan.
Key Features For the Heat Sink Fan, we want to add a second fan to the PCR machine. The reason for adding an additional fan would be cool the heat sink down more rapidly. If we are able to cool the heat sink down faster it would speed up the whole process all together. We also want to change the heat sink in general by add more surface area to the metal sheets in the center. We would increase the number of sheets vertically, reducing space between sheets, and we would also add two to three sheets horizontally, to increase the surface area even more. Adding more surface allows the heat sink to drain heat more rapidly, which then cuts down the transition between cycles.
Instructions The instructions for assembly or use of the machine would not change. To add the second fan, though, we would have to expand the exterior walls to make room for it. This would make the machine slightly larger, but not change its compact, portable size.
Protocols
Materials
| Supplied in Kit | Amount
|
| -PCR machine
|
| -Buffer | -3200 mL
|
| -Eppendorf | -12
|
| -Sybr green solution | -Full Eppendorf tube
|
| -DNA calf thymus | -2 microg/mL (full Eppendorf tube)
|
| -Pipettes | -20
|
| -Glass slides | -5
|
| -Black box
|
| -Buffer | -4000mL
|
| -Master mix | -100 μL
|
| -Phone holder
|
| -Scintillation vial
|
| -Fluorimeter
|
Supplied by User
-Waste cup
-Paper towels
-Smart phone with camera
-Computer with Image J program
-Sharpie pen
-Power source
PCR Protocol
1. Transfer the PCR reaction mix (50 μL each tube cointaining Taq DNA polymerase, MgCl2, dNTP's, forward primer, reverse prime) into the micro-test tubes which will be used within the PCR machine.
2. Place up to 16 micro test into the PCR Machine and lower and lock the lid.
3. Run the open PCR program on a computer connected by usb to the PCR machine and set the cycles to:
Stage one: 1 cycle at 95 degrees Celsius for 3 minutes
Stage two: 30 cycles at 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius for 30 seconds
Stage Three: 72 degrees Celsius for 3 minutes
Final Hold: 4 degrees Celsius
The program is very user friendly and is already pre-programmed so all you need for a basic PCR run is a power source.
The whole process will take about 3 hours to complete due to the amount of time it takes to transition from temperatures.
DNA Measurement Protocol
1. Label each pipette bulb, using sharpie, with the sample name it will be used for (ex: "c+" or "1-3" as in patient 1-replicate 3)
2. label each Eppendorf tube, using sharpie, with the same name corresponding to the pipette
3. Using only one designated pipette per sample transfer the each sample into separate Eppendorf tubes filled with 400mL of buffer solution. make sure to label the buffer tube with the corresponding sample name (ex: "c+" or "1-2")
4. To set up fluorimeter, slide one glass slide into slit with the gritty side facing up and slide the glass so that the light is aligned between the first two holes
5. Using pipette designated for sample , place one drop on each of the two holes on the glass slide
6. Using pipette designated for sybr green solution, place two drops in between the two drops of sample, this should create one big drop of liquid
7. Realign the light to make sure it is going through the drop of liquid
8. Place smart phone is phone holder and set in front of fluorimeter making sure camera can clearly see drop of liquid
9. Place black box over phone in holder and flourimeter to darken area
10. Press screen camera on the drop to focus camera
11. Take picture of drop covering area from light as best as possible
12. Once picture is taken, make sure to write down the name of the picture in the phone as it corresponds to the sample in a chart
13. Using a pipette designated for waste, suck up the drop, squeeze into waste cup, and slide glass so that light is between the next two holes
14. Repeat steps 5 through 13 for all patients samples and controls, keep in mind that each slide can run five samples so glass slides must be changed every 5 samples
15. For water sample, place three drops on the glass slide (one on each hole and one in the middle) to create one drop of pure water and follow steps 7 through 13
16. follow step 15 for calf thymus instead of water
17. after all pictures are taken, send them to email. make sure that each picture is label with which sample when sending picture to avoid mixups.
18. download all pictures from email to computer
19. open ImageJ program on computer
20. click "file" then "open" and select picture you wish the process
21. after images are processed, view each one to see green pigments are seen in the samples, if green appears the sample is positive for cancer (positive control sample must be green to justify experimental control)
Research and Development
Background on Disease Markers
Cystic fibrosis is a disease that can be passed on down genetically along the familial line. The disease causes a build up of thick mucus on the inside of the lungs, digestive tract and other parts of the body. Cystic Fibrosis is the most common chronic lung disease to effect children and young adults and is usually diagnosed by the age of two; however, there are weaker strains of the disease that often go un-diagnosed until the age of 18 or later. The disease is recessive so to suffer the disease one must have the gene from both parents. The disease is life-threatening, the mucus builds up and can eventually suffocate the victim. Around 1 in 29 Caucasians of middle European dissent suffer from cystic fibrosis, this is the most susceptible group to this disease.
One such SNP which signals for a susceptibility to Cystic Fibrosis is the [A/G] swap changing the codon from TGG ⇒ TGA. This change has been recorded in two patients suffering from cystic fibrosis the swap occurs at nucleotide 302 in exon 3 converting codon 57 from TGG (trp) to TGA (stop).
More information can be found: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121909025
Primer Design
The primers must be built around the sequence CGTCTCTAC[T/C]CTATCTCTC with the thymine swapped for the cytosine giving the primers:
Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5'
Forward primer: 5' AAATATCTGGCTGAGTGTTT 3'
These primers are 150 bp apart so as to allow the PCR reaction to occur faster, shortening the 30 seconds required per temperature cycled to 10 seconds per cycle.
Illustration
Forward and reverse primers binding to the SNP signaling Cystic Fibrosis.
< >
Image credit to www.nature.com
Pray, Leslie A., Ph.D. "The Biotechnology Revolution: PCR and the Use of Reverse Transcriptase to Clone Expressed Genes." Nature.com. Nature Publishing Group, 2008. Web. 15 Nov. 2012.
General PCR is very similar to our new version of PCR. The only difference is that our primers are only fifteen base pairs long and will be only 150 base pairs apart. So each copied segment in this illustration is 150 base pairs long and the primers look like the first illustration.
|