BME103:T930 Group 13: Difference between revisions
Allen Janis (talk | contribs) |
Allen Janis (talk | contribs) |
||
Line 146: | Line 146: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees | Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees Celsius where TAQ polymerase copies all the DNA after the primers. Given everything else for the PCR reaction the success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: TGGTATAAGACATTCCTGTC and the reverse primer is: AACTCTTACACTGCATACAT. The specific change in these primers occurs with the change from the typical CHEK2 gene at the 8,511,656 base pair (the 11th nucleotide in the reverse primer) switches a cytosine with a thymine. <br> Therefore only DNA segments that match these primers will be amplified. This method of replicating DNA works by having the two primers anneal to different strands of DNA and replicating in one direction. This process leaves two partial strands of DNA which is not the target sequence, however, it does contain the target sequence. Over the next few cycles the other primer will anneal to the same strand of DNA (if the forward annealed to it first then the reverse will anneal to it and vice versa). After annealing it will copy in the other direction and end where the other primer started giving you the 200 base pair target sequence. Because only segments with the primers are amplified if the patient does not have this r17879961 single nucleotide polymorphism (SNP) the DNA will not be amplified. Therefore the positive result for having the r17879961 SNP is the presence of amplified DNA in the PCR reaction. | ||
<br> | <br> | ||
Revision as of 10:19, 15 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
THE A TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections To test the machine and it's connectivity several simple tests were run. First we unplugged the LCD Display from the ??CPU??. The LCD Display remained powered on but displayed a set of random numbers. This that it was no longer receiving information from the CPU. When we unplugged the white wire that connects the circuit board to the main heating block,the LCD displayed a reading of -40 degrees on the machine. Test Run October 25, 2012: We used machine number 11, it ran a bit slow but over all performed well. The worst about the machine was that it took much longer then other groups, and the readings for how long was left never updated on the computer. The only way to tell how long we had left was by looking at the LCD screen on the machine itself.
Protocols
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees Celsius where TAQ polymerase copies all the DNA after the primers. Given everything else for the PCR reaction the success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: TGGTATAAGACATTCCTGTC and the reverse primer is: AACTCTTACACTGCATACAT. The specific change in these primers occurs with the change from the typical CHEK2 gene at the 8,511,656 base pair (the 11th nucleotide in the reverse primer) switches a cytosine with a thymine.
Pray, Leslie A., Ph.D. "The Biotechnology Revolution: PCR and the Use of Reverse Transcriptase to Clone Expressed Genes." Nature.com. Nature Publishing Group, 2008. Web. 15 Nov. 2012.
ResultsProcedure using Droid Phone
|