BME103:T930 Group 13: Difference between revisions
Pete Marple (talk | contribs) |
Pete Marple (talk | contribs) |
||
Line 50: | Line 50: | ||
<font size="4">'''Polymerase Chain Reaction'''</font> | <font size="4">'''Polymerase Chain Reaction'''</font> | ||
<br> | |||
'''How it Works'''<br> | '''How it Works'''<br> | ||
In order to analyze genomes and genes,scientists have used polymerase chain reaction (PCR) techniques to amplify DNA. Multiple copies of DNA sequences much be made to be able to better view specific aspects of a gene due to the fact that isolated DNA samples are too small to view individually. In a test tube, PCR takes place by copying short fragments of DNA over and over again, also known as amplification. By altering the temperature within the test tubes, this allows the DNA strands to separate (boiling), bind to primers (cooled),and catalyze (warmed) to double the amount of DNA fragments after each cycle. By repeating each cycle the amount to DNA grows exponentially as two copies are made per strand. | In order to analyze genomes and genes,scientists have used polymerase chain reaction (PCR) techniques to amplify DNA. Multiple copies of DNA sequences much be made to be able to better view specific aspects of a gene due to the fact that isolated DNA samples are too small to view individually. In a test tube, PCR takes place by copying short fragments of DNA over and over again, also known as amplification. By altering the temperature within the test tubes, this allows the DNA strands to separate (boiling), bind to primers (cooled),and catalyze (warmed) to double the amount of DNA fragments after each cycle. By repeating each cycle the amount to DNA grows exponentially as two copies are made per strand. | ||
<br> | |||
'''How to Amplify a Patient's DNA'''<br> | '''How to Amplify a Patient's DNA'''<br> | ||
1. After the Patients DNA is placed in to the test tubes along with the Master Mix, the tubes are placed into the PCR machine.<br> | 1. After the Patients DNA is placed in to the test tubes along with the Master Mix, the tubes are placed into the PCR machine.<br> | ||
Line 62: | Line 62: | ||
5. Once steps 2-4 are repeated several times, each cycle will create newly replicated DNA stands and allow replication to continue until Master Mix is used up.<br> | 5. Once steps 2-4 are repeated several times, each cycle will create newly replicated DNA stands and allow replication to continue until Master Mix is used up.<br> | ||
<br> | |||
'''PCR Master Mix Components'''<br> | '''PCR Master Mix Components'''<br> | ||
For a 50µl reaction volume: | For a 50µl reaction volume: | ||
Line 73: | Line 73: | ||
<br> | |||
'''Substances in Test Tubes'''<br> | '''Substances in Test Tubes'''<br> | ||
{| border="1" class="wikitable" | {| border="1" class="wikitable" | ||
Line 93: | Line 93: | ||
<br> | |||
'''Patient Numbers'''<br> | '''Patient Numbers'''<br> | ||
Patient #29341 is female at the age of 53.<br> | Patient #29341 is female at the age of 53.<br> | ||
Line 99: | Line 99: | ||
<br> | |||
<font size="4">'''Flourimeter'''</font> | <font size="4">'''Flourimeter'''</font> | ||
<br> | |||
'''Flourimeter Setup'''<br> | '''Flourimeter Setup'''<br> | ||
[[Image:BME103_Group13_Protocol.jpg|350px|Flourimeter Setup]] | [[Image:BME103_Group13_Protocol.jpg|350px|Flourimeter Setup]] | ||
Line 108: | Line 108: | ||
<br> | |||
'''Flourmeter Assembly Procedure'''<br> | '''Flourmeter Assembly Procedure'''<br> | ||
(step by step) | (step by step) | ||
<br> | |||
'''Saving Images to ImageJ'''<br> | '''Saving Images to ImageJ'''<br> | ||
1. Open ImageJ | 1. Open ImageJ |
Revision as of 11:40, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP(Please finish by 11/7/2012) Initial Machine TestingThe Original Design
Experimenting With the Connections When we unplugged the LCD display from the circuit board, the LCD display for the machine was no longer functional. When we unplugged the white wire that connects the circuit board to the main heating block,the LCD displayed a reading of -40 degrees on the machine. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
Protocols
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees celsius where TAQ polymerase copies all the DNA after the primers. Given everything else for the PCR reaction the success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: TGGTATAAGACATTCCTGTC and the reverse primer is: AACTCTTACACTGCATACAT.
ResultsProcedure using Droid Phone
|