BME103:T930 Group 13: Difference between revisions
Line 56: | Line 56: | ||
<br><br> | <br><br> | ||
'''How to Amplify a Patient's DNA'''<br> | '''How to Amplify a Patient's DNA'''<br> | ||
1. After the Patients DNA is placed in to the test tubes along with the Master Mix, the tubes are placed into the PCR machine. | 1. After the Patients DNA is placed in to the test tubes along with the Master Mix, the tubes are placed into the PCR machine.<br> | ||
2. As the machine warms to almost a boil, at 95 degrees Celsius, the DNA strands will begin to separate. | 2. As the machine warms to almost a boil, at 95 degrees Celsius, the DNA strands will begin to separate. <br> | ||
3. Once the PCR machine has cooled down to 57 degrees Celsius, the primer will bind to the target sequence. | 3. Once the PCR machine has cooled down to 57 degrees Celsius, the primer will bind to the target sequence. <br> | ||
4. The PCR machine needs to then warm back up to 72 degrees Celsius in order for extension of DNA to occur. This initiates the taq function where the taq protein, along with magnesium chloride, takes free floating nucleotides (DNTPs) and attaches them to the DNA stand in a reverse direction. | 4. The PCR machine needs to then warm back up to 72 degrees Celsius in order for extension of DNA to occur. This initiates the taq function where the taq protein, along with magnesium chloride, takes free floating nucleotides (DNTPs) and attaches them to the DNA stand in a reverse direction.<br> | ||
5. Once steps 2-4 are repeated several times, each cycle will create newly replicated DNA stands and allow replication to continue until Master Mix is used up. | 5. Once steps 2-4 are repeated several times, each cycle will create newly replicated DNA stands and allow replication to continue until Master Mix is used up.<br> | ||
<br><br> | <br><br> |
Revision as of 00:24, 12 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP(Please finish by 11/7/2012) Initial Machine TestingThe Original Design
Experimenting With the Connections When we unplugged the LCD display from the circuit board, the LCD display for the machine was no longer functional. When we unplugged the white wire that connects the circuit board to the main heating block,the LCD displayed a reading of -40 degrees on the machine. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
Protocols
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees celsius where TAQ polymerase copies all the DNA after the primers. Given everything else for the PCR reaction the success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: TGGTATAAGACATTCCTGTC and the reverse primer is: AACTCTTACACTGCATACAT.
ResultsProcedure using Droid Phone
|