BME103:T930 Group 13

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Pete Marple Experimental Protocol Planner Name: Michelle Lipowicz Experimental Protocol Planner Name: Allen Janis R&D Scientist Name: Ian Bainbridge R&D Scientist Name: Marcus Sansoni Open PCR Machine Engineer Name: Tyler Barnes Open PCR Machine Engineer LAB 1 WRITE-UP (Please finish by 11/7/2012) Initial Machine Testing The Original Design http://openwetware.org/images/4/41/PCR_Machine.png The original machine design from the OpenPCR design team. Used as an affordable tool to amplify a DNA sequence using Polymerase Chain Reaction. You can find information on the OpenPCR device here. Experimenting With the Connections When we unplugged the LCD display from the circuit board, the LCD display for the machine was no longer functional. When we unplugged the white wire that connects the circuit board to the main heating block,the LCD displayed a reading of -40 degrees on the machine. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine) Protocols Polymerase Chain Reaction Reagent Volume Template DNA (20 ng) .2 μL 10 μM forward primer 1.0 μL 10 μM reverse primer 1.0 μL GoTaq master mix 50.0 μL dH20 47.8 μL Total Volume 100.0 μL Patient #29341 is female at the age of 53. Patient #23292 is male at the age of 56. Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees celsius where TAQ polymerase copies all the DNA after the primers. Given everything else for the PCR reaction the success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: TGGTATAAGACATTCCTGTC and the reverse primer is: AACTCTTACACTGCATACAT. Therefore only DNA segments that match these primers will be amplified. This method of replicating DNA works by having the two primers anneal to different strands of DNA and replicating in one direction. This process leaves two partial strands of DNA which is not the target sequence, however, it does contain the target sequence. Over the next few cycles the other primer will anneal to the same strand of DNA (if the forward annealed to it first then the reverse will anneal to it and vice versa). After annealing it will copy in the other direction and end where the other primer started giving you the 200 base pair target sequence. Because only segments with the primers are amplified if the patient does not have this r17879961 single nucleotide polymorphism (SNP) the DNA will not be amplified. Therefore the positive result for having the r17879961 SNP is the presence of amplified DNA in the PCR reaction. <http://openwetware.org/images/1/1f/Acetic_acid_db.jpeg> (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results Procedure using Droid Phone Image Number Drop 1 Drop 2 Comments 210 SYBRGreen -Control * 211 SYBRGreen 2-1 * 212 SYBRGreen 2-2 * 213 SYBRGreen 2-3 * 214 SYBRGreen +Control * 215 SYBRGreen 1-1 * 216 SYBRGreen 1-2 * 217 SYBRGreen 1-3 * 218 SYBRGreen Red * Sample Area Mean Pixel Value INTDEN RAWINTDEN INTDEN * * * * * Description Eppendorf Tube Label Pipette Label * * * Description INTDEN with background subtracted DNA Concentration (μg/mL) * * *