BME103:T930 Group 13: Difference between revisions
Allen Janis (talk | contribs) |
|||
Line 143: | Line 143: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees Celsius where TAQ polymerase copies all the DNA after the primers. Given everything else for the PCR reaction the success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: TGGTATAAGACATTCCTGTC and the reverse primer is: AACTCTTACACTGCATACAT. The specific change in these primers occurs with the change from the typical CHEK2 gene at the 8,511,656 base pair (the 11th nucleotide in the reverse primer) where a cytosine is replaced by a thymine. <br> Therefore only DNA segments that match these primers will be amplified. This method of replicating DNA works by having the two primers anneal to different strands of DNA and replicating in one direction. This process leaves two partial strands of DNA which is not the target sequence, however, it does contain the target sequence. Over the next few cycles the other primer will anneal to the same strand of DNA (if the forward annealed to it first then the reverse will anneal to it and vice versa). After annealing it will copy in the other direction and end where the other primer started giving you the 200 base pair target sequence. Because only segments with the primers are amplified if the patient does not have this r17879961 single nucleotide polymorphism (SNP) the DNA will not be amplified. Therefore the positive result for having the r17879961 SNP is the presence of amplified DNA in the PCR reaction. | Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees Celsius where TAQ polymerase copies all the DNA after the primers. Given everything else for the PCR reaction the success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: 3' TGGTATAAGACATTCCTGTC 5' and the reverse primer is: 5' AACTCTTACACTGCATACAT 3'. The reverse primer contains the specific SNP for this gene and the forward primer is 200 bp left of the reverse primer. The specific change in these primers occurs with the change from the typical CHEK2 gene at the 8,511,656 base pair (the 11th nucleotide in the reverse primer) where a cytosine is replaced by a thymine. <br> Therefore only DNA segments that match these primers will be amplified. This method of replicating DNA works by having the two primers anneal to different strands of DNA and replicating in one direction. This process leaves two partial strands of DNA which is not the target sequence, however, it does contain the target sequence. Over the next few cycles the other primer will anneal to the same strand of DNA (if the forward annealed to it first then the reverse will anneal to it and vice versa). After annealing it will copy in the other direction and end where the other primer started giving you the 200 base pair target sequence. Because only segments with the primers are amplified if the patient does not have this r17879961 single nucleotide polymorphism (SNP) the DNA will not be amplified. Therefore the positive result for having the r17879961 SNP is the presence of amplified DNA in the PCR reaction. A positive result was detected by using an image of the DNA dyed with Sybr green dye taken in a a black box. The concentration of DNA could be detected by measuring the amount of fluorescence in the picture. | ||
<br> | <br> | ||
In the specific case of these patients, 1.1% of of the population of 180 suffered from the C/T mutation. This mutation shows a significant link to breast and colorectal cancer as well as a susceptibility for Li-Fraumeni syndrome. | Bayes Rule | ||
<br> | |||
The Bayes rule is: p(C/T)= [p(T/C)*p(C)]/[{p(T/C)*p(C)}+{p(T/~C)*p(~C)}] | |||
<br> | |||
In the specific case of these patients, 1.1% of of the population of 180 suffered from the C/T mutation leaving 98.9% with the normal gene. This mutation shows a significant link to breast and colorectal cancer as well as a susceptibility for Li-Fraumeni syndrome. A study conducted in Finland found that this mutation occurred in 7.8% the population suffering from caner and only 5.3% of people not suffering from caner. | |||
<br> | <br> | ||
Revision as of 10:55, 15 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
THE A TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections To test the machine and it's connectivity several simple tests were run. First we unplugged the LCD display from the CPU, which caused the LCD display to lose power. We also unplugged the connection between the circuit board and the main heating block. After this connection was severed the LCD displayed a reading of -40 °C.
Protocols
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine which will cycle through the heats 95 degrees celsius to 57 degrees celsius to 72 degrees celsius and repeat that cycle thirty times. When the temperature is 95 degrees the DNA double helix denatures into individual single strands. After which, when the temperature is lowered to 57 degrees, the primers anneal to the single strand of DNA in preparation for replication. Then the sample is heated to 72 degrees Celsius where TAQ polymerase copies all the DNA after the primers. Given everything else for the PCR reaction the success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: 3' TGGTATAAGACATTCCTGTC 5' and the reverse primer is: 5' AACTCTTACACTGCATACAT 3'. The reverse primer contains the specific SNP for this gene and the forward primer is 200 bp left of the reverse primer. The specific change in these primers occurs with the change from the typical CHEK2 gene at the 8,511,656 base pair (the 11th nucleotide in the reverse primer) where a cytosine is replaced by a thymine. <http://openwetware.org/images/1/1f/Acetic_acid_db.jpeg>
Pray, Leslie A., Ph.D. "The Biotechnology Revolution: PCR and the Use of Reverse Transcriptase to Clone Expressed Genes." Nature.com. Nature Publishing Group, 2008. Web. 15 Nov. 2012.
ResultsDNA Measurement Procedure using Fluorimeter
|