BME103:T930 Group 12 l2

From OpenWetWare

Revision as of 23:55, 28 November 2012 by Nathan Moore (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Divya Amrelia PCR engineer
Name: Divya Amrelia
PCR engineer
Name: David TzePCR engineer
Name: David Tze
PCR engineer
Name: Nathan MooreProtocol Planner
Name: Nathan Moore
Protocol Planner
Name: Philip RemickProtocol Planner
Name: Philip Remick
Protocol Planner
Name: Ryan MagnusonR&D Scientist
Name: Ryan Magnuson
R&D Scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.<

System Design
Image:Heat block group 12 changes.png

The picture above is of the original 4x4 PCR Tube Block which we are redesigning. The purpose of the PCR Tube Block is to hold the samples of DNA. In our redesign of the PCR Block, we are manipulating the sample size to a 3x7 block, making it capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 sample spaces will be inserted with a platinum temperature sensor.


Key Features
PCR Tube Block.:
Our lab group is targeting the process time of the Open PCR; we want to make it quicker and more efficient. In the new design, the PCR Tube Block has been expanded to 21 spaces to encompass more DNA samples. As samples of DNA are usually done in pairs, the last space will be used to insert a platinum temperature sensor, one of the most accurate sensors. This new placement will develop more accurate readings as the position is identical to what we are measuring: the DNA samples. The accurate temperature readings, along with the increase in sample size, will make the Open PCR more efficient as it minimizes the chance of overheating or over-cooling. This prevention saves wasted time created by inaccurate readings.


Instructions
The assembly instructions will not change too drastically. First, a new heating lid must be made to fit the size of the new PCR Tube Block. The space containing the current PCR Tube Block would also need to be enlarged. As a result, the modified Open PCR will be slightly larger. After all the parts are readjusted to fit the new PCR Tube Block, insert a platinum temperature sensor into a sample space. Once this is complete, follow the original assembly instructions as they will be identical.




Protocols

Supplied in the Kit Amount
Micro-pipetter 1
Pipetter tips Set of 40
Labeled Test Tubes Set of 8
Better Software 1 Disk
Primer Mix 3 Sets


Supplied by User Amount
Lab Coat 1
Sterile gloves 1
Test Samples Varies
GoTaq master mix 50.0 μL
dH20 47.8 μL
Total Volume 100.0 μL

PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers
We decided to research and to design primers that will help detect a specific SNP that causes Alzheimer’s disease. Alzheimer’s disease is a form of dementia that affects one in eight older Americans and is the sixth-leading cause of death in the United States (http://www.alz.org/alzheimers_disease_facts_and_figures.asp). It is usually present in people of 65 years of age and older, and causes cognitive deterioration ranging in severity and rate. The average person diagnosed with Alzheimer’s disease lives around 8 to 12 years after diagnoses (http://www.agingcare.com/Answers/How-long-does-Alzheimer-s-disease-last-on-average-133298.htm).

One of the SNP’s (single nucleotide polymorphism) associated with Alzheimer’s is Rs4934, located in chromosome 14, at position # 95,080,803. This missense mutation causes an allele change of GCT ⇒ ACT and is associated with the gene SERPINA3. People with this mutation have a 2.5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934 present in the OMIM database.

DNA Sequence:
5'GAATGGAGAGAATGTTACCTCTCCTG[A/G]CTCTGGGGCTCTTGGCGGCTGGGTT3’
3’CTTACCTCTCTTACAATGGAGAGGAC[T/C]GAGACCCCGAGAACCGCCGACCCAA5’



Primer Design

Forward Primer:
3’TGGAGAGGACCGAGACCCCG5’

Reverse Primer (150 basepairs to the left)
5’TGAGGGAGGCTCCAAAGCTA3’

The specific disease allele for Rs4934 will give a positive result and a non-disease will not because, the forward and reverse primers were designed to only attach to DNA strands with the GCT ⇒ ACT mutation at position # 95,080,803. Exponential replication will only occur in the strands of which the primers bind to. Because the non-disease allele strands will have a mismatching nucleotide with the primers,(a G instead of C at position # 95,080,803), the primers will not bind to them, making exponential replication impossible.



Illustration

illustration
Click on image for enlarged view.


Personal tools