BME103:T930 Group 12 l2

From OpenWetWare

Revision as of 19:59, 28 November 2012 by Divya Amrelia (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Wiki Editing Help



Name: Divya Amrelia PCR engineer
Name: Divya Amrelia
PCR engineer
Name: David TzePCR engineer
Name: David Tze
PCR engineer
Name: Nathan MooreProtocol Planner
Name: Nathan Moore
Protocol Planner
Name: Philip RemickProtocol Planner
Name: Philip Remick
Protocol Planner
Name: Ryan MagnusonR&D Scientist
Name: Ryan Magnuson
R&D Scientist


Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.<

System Design
Image:Heat block group 12 changes.png

Our design manipulates the 4x4 PCR Tube Block to a 3x7 block capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 test tube spaces will be inserted with a platinum temperature sensor. The platinum temperature sensor reads the temperature more accurately, and since it reads the temperature more accurately it saves more time.

Key Features
PCR Tube Block In the new design, the PCR Tube Block has been expanded to 21 spaces to encompass more DNA samples. One of these 21 spaces will be inserted with a platinum temperature sensor, since platinum has a predictable change to temperature. Using this platinum temperature sensor will ensure that the enlarged PCR Block will have accurate temperature readings. Since the temperature readings are accurate, this will also save more time for the user.




PCR Protocol

DNA Measurement Protocol

Research and Development

Background on Disease Markers We decided to research and to design primers that will help detect a specific SNP that causes Alzheimer’s disease. Alzheimer’s disease is a form of dementia that affects one in eight older Americans and is the sixth-leading cause of death in the United States ( It is usually present in people of 65 years of age and older, and causes cognitive deterioration ranging in severity and rate. The average person diagnosed with Alzheimer’s disease lives around 8 to 12 years after diagnoses ( One of the SNP’s (single nucleotide polymorphism) associated with Alzheimer’s is Rs4934, located in chromosome 14, at position # 95,080,803. This missense mutation causes an allele change of GCT ⇒ ACT and is associated with the gene SERPINA3. People with this mutation have a 2.5x increased risk of Alzheimer’s and decreased age at onset (;A). There was no information pertaining to Rs4934 present in the OMIM database.
1. Alzheimer’s Disease • Gene being affected: SERPINA3 • SNP (Single Nucleotide Polymorphism): Rs4934 • Located in position # 95,080,803 5'GAATGGAGAGAATGTTACCTCTCCTG[A/G]CTCTGGGGCTCTTGGCGGCTGGGTT3’ • 3’CTTACCTCTCTTACAATGGAGAGGAC[T/C]GAGACCCCGAGAACCGCCGACCCAA5’ • Forward Primer: o 3’TGGAGAGGACCGAGACCCCG5’ • Reverse Primer (150 basepairs to the left) o 5’TGAGGGAGGCTCCAAAGCTA3’ • Causes 2.5x increase risk of Alzheimer’s and decreased age at onset

Primer Design Surrounding sequence of Rs4934: 5' GAATGGAGAGAATGTTACCTCTCCTG[A/G]CTCTGGGGCTCTTGGCGGCTGGGTT 3’ 3’ CTTACCTCTCTTACAATGGAGAGGAC[T/C]GAGACCCCGAGAACCGCCGACCCAA 5’ Forward Primer: 3’TGGAGAGGACCGAGACCCCG5’ Reverse Primer (150 basepairs to the left): 5’TGAGGGAGGCTCCAAAGCTA3’ The specific disease allele for Rs4934 will give a positive result and a non-disease will not because, the forward and reverse primers were designed to only attach to DNA strands with the GCT ⇒ ACT mutation at position # 95,080,803. Exponential replication will only occur in the strands of which the primers bind to. Because the non-disease allele strands will have a mismatching nucleotide with the primers,(a G instead of C at position # 95,080,803), the primers will not bind to them, making exponential replication impossible.


Click on image for enlarged view.

Personal tools