BME103:T930 Group 12 l2: Difference between revisions
Line 98: | Line 98: | ||
• '''3’'''CTTACCTCTCTTACAATGGAGAGGAC'''[T/C]'''GAGACCCCGAGAACCGCCGACCCAA'''5’'''<br><br> | • '''3’'''CTTACCTCTCTTACAATGGAGAGGAC'''[T/C]'''GAGACCCCGAGAACCGCCGACCCAA'''5’'''<br><br> | ||
• Forward Primer:<br> | • Forward Primer:<br> | ||
• '''3’'''TGGAGAGGAC'''C'''GAGACCCCG'''5’'''<br><br> | |||
• Reverse Primer (150 basepairs to the left)<br> | • Reverse Primer (150 basepairs to the left)<br> | ||
• '''5’'''TGAGGGAGGC'''T'''CCAAAGCTA3’'''<br><br> | |||
The specific disease allele for Rs4934 will give a positive result and a non-disease will not because, the forward and reverse primers were designed to only attach to DNA strands with the '''G'''CT ⇒ '''A'''CT mutation at position # 95,080,803. Exponential replication will only occur in the strands of which the primers bind to. Because the non-disease allele strands will have a mismatching nucleotide with the primers,(a G instead of C at position # 95,080,803), the primers will not bind to them, making exponential replication impossible. | The specific disease allele for Rs4934 will give a positive result and a non-disease will not because, the forward and reverse primers were designed to only attach to DNA strands with the '''G'''CT ⇒ '''A'''CT mutation at position # 95,080,803. Exponential replication will only occur in the strands of which the primers bind to. Because the non-disease allele strands will have a mismatching nucleotide with the primers,(a G instead of C at position # 95,080,803), the primers will not bind to them, making exponential replication impossible. |
Revision as of 19:11, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.< Our design manipulates the 4x4 PCR Tube Block to a 3x7 block capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 test tube spaces will be inserted with a platinum temperature sensor. The platinum temperature sensor reads the temperature more accurately, and since it reads the temperature more accurately it saves more time.
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
Primer Design
Illustration
|