BME103:T930 Group 12 l2
From OpenWetWare
(→Research and Development) |
Current revision (13:41, 29 November 2012) (view source) (→OUR TEAM) |
||
| (38 intermediate revisions not shown.) | |||
| Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- | ||
| - | | [[Image: | + | | [[Image:Baldy.jpg|100px|thumb|Name: Divya Amrelia<br> PCR engineer]] |
| - | | [[Image: | + | | [[Image:Jackiechan.jpg|100px|thumb|Name: David Tze<br>PCR engineer]] |
| - | | [[Image: | + | | [[Image:Chuck-norris.jpg|100px|thumb|Name: Nathan Moore<br>Protocol Planner]] |
| - | | [[Image: | + | | [[Image:Lamborghini.jpg|100px|thumb|Name: Philip Remick<br>Protocol Planner]] |
| - | | [[Image: | + | | [[Image:Arnold.jpg|100px|thumb|Name: Ryan Magnuson<br>R&D Scientist]] |
|} | |} | ||
| Line 30: | Line 30: | ||
[[Image:Heat block group 12 changes.png]] | [[Image:Heat block group 12 changes.png]] | ||
| - | + | The picture above is of the original 4x4 PCR Tube Block which we are redesigning. The purpose of the PCR Tube Block is to hold the samples of DNA. In our redesign of the PCR Block, we are manipulating the sample size to a 3x7 block, making it capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 sample spaces will contain a platinum temperature sensor. | |
'''Key Features'''<br> | '''Key Features'''<br> | ||
| - | '''PCR Tube Block''' | + | '''PCR Tube Block.''':<br> |
| - | In the new design, the PCR Tube Block has been expanded to 21 spaces to encompass more DNA samples. | + | Our lab group is targeting the process time of the Open PCR; we want to make it quicker and more efficient. In the new design, the PCR Tube Block has been expanded to 21 spaces to encompass more DNA samples. As samples of DNA are usually done in pairs, the last space will be used to insert a platinum temperature sensor, one of the most accurate sensors. This new placement will develop more accurate readings as the position is identical to what we are measuring: the DNA samples. The accurate temperature readings, along with the increase in sample size, will make the Open PCR more efficient as it minimizes the chance of overheating or over-cooling. This prevention saves wasted time created by inaccurate readings. Another change we are making to shorten the process time is shortening the number of base pairs to 150. This difference will cut twenty seconds off the process of each sample and shorten the initial melting point from three minutes to one. |
| - | + | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
| - | + | The assembly instructions will not change too drastically. First, a new heating lid must be made to fit the size of the new PCR Tube Block. The space containing the current PCR Tube Block would also need to be enlarged. As a result, the modified Open PCR will be slightly larger. After all the parts are readjusted to fit the new PCR Tube Block, insert a platinum temperature sensor into a sample space. Once this is complete, follow the original assembly instructions as they will be identical. | |
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 63: | Line 62: | ||
'''Materials''' | '''Materials''' | ||
| - | + | {|border="1" cellpadding="5" cellspacing="0" align="center" | |
| + | |- | ||
| + | ! scope="col" | Supplied in the Kit | ||
| + | ! scope="col" | Amount | ||
| + | |- | ||
| + | |Micro-pipetter | ||
| + | |1 | ||
| + | |- | ||
| + | |Pipetter tips | ||
| + | |Set of 40 | ||
| + | |- | ||
| + | |Labeled Test Tubes | ||
| + | |Set of 8 | ||
| + | |- | ||
| + | |Better Software | ||
| + | |1 Disk | ||
| + | |- | ||
| + | |Primer Mix | ||
| + | |3 Sets | ||
| + | |- | ||
| + | |PCR Machine | ||
| + | |1 | ||
| + | |- | ||
| + | |Fluorimeter | ||
| + | |1 | ||
| + | |- | ||
| + | |Phone Holder | ||
| + | |1 | ||
| + | |- | ||
| + | |Tris Buffer (SYBR Green 0.025%) | ||
| + | |Enough for samples | ||
| + | |- | ||
| + | |GoTaq® Colorless Master Mix | ||
| + | |1 | ||
| + | |- | ||
| + | |Black Box | ||
| + | |1 | ||
| + | |} | ||
| + | |||
| + | |||
| + | |||
| + | {|border="1" cellpadding="5" cellspacing="0" align="center" | ||
| + | |- | ||
| + | ! scope="col" | Supplied by User | ||
| + | ! scope="col" | Amount | ||
| + | |- | ||
| + | |Lab Coat | ||
| + | |1 | ||
| + | |- | ||
| + | |Sterile gloves | ||
| + | |1 | ||
| + | |- | ||
| + | |Goggles | ||
| + | |One Pair | ||
| + | |- | ||
| + | |Test Samples | ||
| + | |Varies | ||
| + | |- | ||
| + | |Smartphone | ||
| + | |1 | ||
| + | |- | ||
| + | |Computer | ||
| + | |1 | ||
| + | |- | ||
| + | |ImageJ Software | ||
| + | |1 | ||
| + | |- | ||
| + | |Distilled Water | ||
| + | |100mL | ||
| + | |} | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
| + | 1. Using the micro-pipetter, transfer primer mix into 8 labeled sample tubes | ||
| + | 2. Transfer samples to assign tubes, ensure tips are replaced for each sample | ||
| + | 3. Place samples in PCR Machine | ||
| + | 4. Run machine to the following setting: | ||
| + | *Stage One: 1 cycle, 95 degrees Celsius, for 1 minute | ||
| + | *Stage Two: 35 cycles, 95 degrees for 10 seconds, 57 degrees for 10 seconds, 72 degrees for 10 seconds. | ||
| + | *Final Hold: 4 Degrees Celsius | ||
'''DNA Measurement Protocol''' | '''DNA Measurement Protocol''' | ||
| + | <em>The steps for setting up the samples:</em><br> | ||
| + | 1. Open the lid of the PCR machine, and remove the 21 samples from the PCR tray. | ||
| + | 2. With the fine point Sharpie, label the transfer pipettes and Eppendorf tubes accordingly to prevent contamination. | ||
| + | 3. Measure 400mL of Tris buffer into a 500mL graduated cylinder and pour into each of the Eppendorf tubes. | ||
| + | |||
| + | 4. Extract each sample with one pipette <b>(use a new one for each sample to prevent contamination)</b> into an Eppendorf tube that contains 400mL of Tris buffer. Be sure to transfer all of the samples into the tubes. | ||
| + | |||
| + | 5. Label the Eppendorf tube with the sample number. | ||
| + | |||
| + | 6. Set up the sample DNA calf thymus by pipetting 100μL into an Eppendorf tube containing 400mL of Tris buffer. | ||
| + | |||
| + | 7. Pipette 100μL of distilled water into the corresponding Eppendorf tube containing 400mL of Tris buffer. | ||
| + | |||
| + | 8. Add the SYBR Green to the Eppendorf tubes with separate pipettes. | ||
| + | |||
| + | 9. Open up the fluorimeter box and remove the contents. | ||
| + | |||
| + | 10. Disassemble the box by unsnapping it. | ||
| + | |||
| + | 11. Put the cover of the box on the bottom facing upside down. | ||
| + | |||
| + | 12. Next, place the fluorimeter on top of the box cover. | ||
| + | |||
| + | 13. Then, carefully add the glass slide in between the fluorimeter. | ||
| + | |||
| + | 14. Use the pipet and remove about .25ml of the sample or water. | ||
| + | |||
| + | 15. Place a few drops from the samples prepared in steps 1-8 in the middle of the slots until they conjoin. | ||
| + | |||
| + | 16. Turn on the LED light. | ||
| + | |||
| + | 17. Make sure the LED is going through the center of the drops, a cone of light should go around it, however, not at an angle. | ||
| + | |||
| + | <em>Steps to setting up camera phone:</em><br> | ||
| + | 18. Carefully place the cell phone stand in front of the fluorimeter. | ||
| + | |||
| + | 19. Configure the cell phone by going to the camera menu and doing the following: | ||
| + | *Inactivate the flash | ||
| + | *Set ISO to 800 (or higher) | ||
| + | *Set white balance to auto | ||
| + | *Set exposure to highest setting | ||
| + | *Set saturation to the highest setting | ||
| + | *Set contrast to the lowest setting | ||
| + | *Set the timer for five seconds | ||
| + | |||
| + | 20. Place the cell phone on the stand and take the picture while placing the cover over the fluorimeter. | ||
| + | |||
| + | 21. Repeat steps 5-12 as necessary. | ||
| + | |||
| + | <em>The Steps for Image J:</em><br> | ||
| + | 22. Download the Image J software. | ||
| + | |||
| + | 23. Save the pictures to smart phone. | ||
| + | |||
| + | 24. Be sure to name the pictures in the correct order taken in order to separate the images. | ||
| + | |||
| + | 25. Download the pictures onto a computer that has Image J through a USB device or uploading them. | ||
| + | |||
| + | 26. Open them with Image J by going to add image. Find image on the files. | ||
| + | |||
| + | <em>Edit the picture:</em><br> | ||
| + | 27. Use the menu selection analyze>set measurements and choose 'area integrated density' and 'mean grey value'. | ||
| + | |||
| + | 28. Use the green image. | ||
| + | |||
| + | 29. Click on the menu bar to activate the oval selection. | ||
| + | |||
| + | 30. Draw the best oval around your green drop image and then select 'analyze>measure'. | ||
| + | |||
| + | 31. Write down the sample number and numbers measured. | ||
| + | |||
| + | 32. Draw another oval for the of the same size in the green file for the background about the drop to get the "noise". Select 'analyze>measure'. Write drown the sample number and the numbers measure and label this as background. Save your measurements. | ||
==Research and Development== | ==Research and Development== | ||
| Line 85: | Line 232: | ||
One of the SNP’s (single nucleotide polymorphism) associated with Alzheimer’s is Rs4934, located in chromosome 14, at position # 95,080,803. This missense mutation causes an allele change of '''G'''CT ⇒ '''A'''CT and is associated with the gene SERPINA3. People with this mutation have a 2.5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934 present in the OMIM database. | One of the SNP’s (single nucleotide polymorphism) associated with Alzheimer’s is Rs4934, located in chromosome 14, at position # 95,080,803. This missense mutation causes an allele change of '''G'''CT ⇒ '''A'''CT and is associated with the gene SERPINA3. People with this mutation have a 2.5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934 present in the OMIM database. | ||
<br><br> | <br><br> | ||
| + | '''DNA Sequence:'''<br> | ||
| + | • '''5''''GAATGGAGAGAATGTTACCTCTCCTG'''[A/G]'''CTCTGGGGCTCTTGGCGGCTGGGTT'''3’''' <br> | ||
| + | • '''3’'''CTTACCTCTCTTACAATGGAGAGGAC'''[T/C]'''GAGACCCCGAGAACCGCCGACCCAA'''5’'''<br><br> | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
| Line 91: | Line 241: | ||
| - | '''Primer Design | + | '''Primer Design'''<br> |
| - | + | ||
| - | + | • '''Forward Primer:'''<br> | |
| - | • | + | • '''3’'''TGGAGAGGAC'''C'''GAGACCCCG'''5’'''<br><br> |
| - | + | • '''Reverse Primer (150 basepairs to the left)'''<br> | |
| - | + | • '''5’'''TGAGGGAGGC'''T'''CCAAAGCTA3’'''<br><br> | |
| - | • | + | |
| - | • | + | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
The specific disease allele for Rs4934 will give a positive result and a non-disease will not because, the forward and reverse primers were designed to only attach to DNA strands with the '''G'''CT ⇒ '''A'''CT mutation at position # 95,080,803. Exponential replication will only occur in the strands of which the primers bind to. Because the non-disease allele strands will have a mismatching nucleotide with the primers,(a G instead of C at position # 95,080,803), the primers will not bind to them, making exponential replication impossible. | The specific disease allele for Rs4934 will give a positive result and a non-disease will not because, the forward and reverse primers were designed to only attach to DNA strands with the '''G'''CT ⇒ '''A'''CT mutation at position # 95,080,803. Exponential replication will only occur in the strands of which the primers bind to. Because the non-disease allele strands will have a mismatching nucleotide with the primers,(a G instead of C at position # 95,080,803), the primers will not bind to them, making exponential replication impossible. | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||
| | |||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.< The picture above is of the original 4x4 PCR Tube Block which we are redesigning. The purpose of the PCR Tube Block is to hold the samples of DNA. In our redesign of the PCR Block, we are manipulating the sample size to a 3x7 block, making it capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 sample spaces will contain a platinum temperature sensor.
ProtocolsMaterials
1. Using the micro-pipetter, transfer primer mix into 8 labeled sample tubes 2. Transfer samples to assign tubes, ensure tips are replaced for each sample 3. Place samples in PCR Machine 4. Run machine to the following setting:
DNA Measurement Protocol The steps for setting up the samples: 2. With the fine point Sharpie, label the transfer pipettes and Eppendorf tubes accordingly to prevent contamination. 3. Measure 400mL of Tris buffer into a 500mL graduated cylinder and pour into each of the Eppendorf tubes. 4. Extract each sample with one pipette (use a new one for each sample to prevent contamination) into an Eppendorf tube that contains 400mL of Tris buffer. Be sure to transfer all of the samples into the tubes. 5. Label the Eppendorf tube with the sample number. 6. Set up the sample DNA calf thymus by pipetting 100μL into an Eppendorf tube containing 400mL of Tris buffer. 7. Pipette 100μL of distilled water into the corresponding Eppendorf tube containing 400mL of Tris buffer. 8. Add the SYBR Green to the Eppendorf tubes with separate pipettes. 9. Open up the fluorimeter box and remove the contents. 10. Disassemble the box by unsnapping it. 11. Put the cover of the box on the bottom facing upside down. 12. Next, place the fluorimeter on top of the box cover. 13. Then, carefully add the glass slide in between the fluorimeter. 14. Use the pipet and remove about .25ml of the sample or water. 15. Place a few drops from the samples prepared in steps 1-8 in the middle of the slots until they conjoin. 16. Turn on the LED light. 17. Make sure the LED is going through the center of the drops, a cone of light should go around it, however, not at an angle. Steps to setting up camera phone: 19. Configure the cell phone by going to the camera menu and doing the following:
20. Place the cell phone on the stand and take the picture while placing the cover over the fluorimeter. 21. Repeat steps 5-12 as necessary. The Steps for Image J: 23. Save the pictures to smart phone. 24. Be sure to name the pictures in the correct order taken in order to separate the images. 25. Download the pictures onto a computer that has Image J through a USB device or uploading them. 26. Open them with Image J by going to add image. Find image on the files. Edit the picture: 28. Use the green image. 29. Click on the menu bar to activate the oval selection. 30. Draw the best oval around your green drop image and then select 'analyze>measure'. 31. Write down the sample number and numbers measured. 32. Draw another oval for the of the same size in the green file for the background about the drop to get the "noise". Select 'analyze>measure'. Write drown the sample number and the numbers measure and label this as background. Save your measurements. Research and DevelopmentBackground on Disease Markers
Primer Design • Forward Primer:
Illustration
| |||||||||||||||||||||||||||||||||||||||||||||||||



