OUR TEAM
Name: Divya Amrelia PCR engineer
| Name: David Tze PCR engineer
| Name: Nathan Moore Protocol Planner
| Name: Philip Remick Protocol Planner
| Name: Ryan Magnuson R&D Scientist
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.<
System Design
The picture above is of the original 4x4 PCR Tube Block which we are redesigning. The purpose of the PCR Tube Block is to hold the samples of DNA. In our redesign of the PCR Block, we are manipulating the sample size to a 3x7 block, making it capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 sample spaces will be inserted with a platinum temperature sensor.
Key Features
PCR Tube Block.:
Our lab group is targeting the process time of the Open PCR; we want to make it quicker and more efficient. In the new design, the PCR Tube Block has been expanded to 21 spaces to encompass more DNA samples. The DNA samples will also be shortened to 150 base pairs since it will only take 10 seconds to process the sample. This shortens the initial melting point from three minutes to one minute. As samples of DNA are usually done in pairs, the last space will be used to insert a platinum temperature sensor, one of the most accurate sensors. This new placement will develop more accurate readings as the position is identical to what we are measuring: the DNA samples. The accurate temperature readings, along with the increase in sample size, will make the Open PCR more efficient as it minimizes the chance of overheating or over-cooling. This prevention saves wasted time created by inaccurate readings.
Instructions
The assembly instructions will not change too drastically. First, a new heating lid must be made to fit the size of the new PCR Tube Block. The space containing the current PCR Tube Block would also need to be enlarged. As a result, the modified Open PCR will be slightly larger. After all the parts are readjusted to fit the new PCR Tube Block, insert a platinum temperature sensor into a sample space. Once this is complete, follow the original assembly instructions as they will be identical.
Protocols
Materials
| Supplied in the Kit
| Amount
|
| Micro-pipetter
| 1
|
| Pipetter tips
| Set of 40
|
| Labeled Test Tubes
| Set of 8
|
| Better Software
| 1 Disk
|
| Primer Mix
| 3 Sets
|
| PCR Machine
| 1
|
| Supplied by User
| Amount
|
| Lab Coat
| 1
|
| Sterile gloves
| 1
|
| Test Samples
| Varies
|
| GoTaq master mix
| 50.0 μL
|
| dH20
| 47.8 μL
|
| Total Volume
| 100.0 μL
|
PCR Protocol
1. Using the micro-pipetter, transfer primer mix into 8 labeled sample tubes
2. Transfer samples to assign tubes, ensure tips are replaced for each sample
3. Place samples in PCR Machine
4. Run machine to the following setting:
- Stage One: 1 cycle, 95 degrees Celsius, for 1 minute
- Stage Two: 35 cycles, 95 degrees for 10 seconds, 57 degrees for 10 seconds, 72 degrees for 10 seconds.
- Final Hold: 4 Degrees Celsius
DNA Measurement Protocol
Research and Development
Background on Disease Markers
We decided to research and to design primers that will help detect a specific SNP that causes Alzheimer’s disease. Alzheimer’s disease is a form of dementia that affects one in eight older Americans and is the sixth-leading cause of death in the United States (http://www.alz.org/alzheimers_disease_facts_and_figures.asp). It is usually present in people of 65 years of age and older, and causes cognitive deterioration ranging in severity and rate. The average person diagnosed with Alzheimer’s disease lives around 8 to 12 years after diagnoses (http://www.agingcare.com/Answers/How-long-does-Alzheimer-s-disease-last-on-average-133298.htm).
One of the SNP’s (single nucleotide polymorphism) associated with Alzheimer’s is Rs4934, located in chromosome 14, at position # 95,080,803. This missense mutation causes an allele change of GCT ⇒ ACT and is associated with the gene SERPINA3. People with this mutation have a 2.5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934 present in the OMIM database.
DNA Sequence:
• 5'GAATGGAGAGAATGTTACCTCTCCTG[A/G]CTCTGGGGCTCTTGGCGGCTGGGTT3’
• 3’CTTACCTCTCTTACAATGGAGAGGAC[T/C]GAGACCCCGAGAACCGCCGACCCAA5’
Primer Design
• Forward Primer:
• 3’TGGAGAGGACCGAGACCCCG5’
• Reverse Primer (150 basepairs to the left)
• 5’TGAGGGAGGCTCCAAAGCTA3’
The specific disease allele for Rs4934 will give a positive result and a non-disease will not because, the forward and reverse primers were designed to only attach to DNA strands with the GCT ⇒ ACT mutation at position # 95,080,803. Exponential replication will only occur in the strands of which the primers bind to. Because the non-disease allele strands will have a mismatching nucleotide with the primers,(a G instead of C at position # 95,080,803), the primers will not bind to them, making exponential replication impossible.
Illustration

Click on image for enlarged view.
|