BME103:T930 Group 12 l2: Difference between revisions
Line 84: | Line 84: | ||
We decided to research and to design primers that will help detect a specific SNP that causes Alzheimer’s disease. Alzheimer’s disease is a form of dementia that affects one in eight older Americans and is the sixth-leading cause of death in the United States (http://www.alz.org/alzheimers_disease_facts_and_figures.asp). It is usually present in people of 65 years of age and older, and causes cognitive deterioration ranging in severity and rate. The average person diagnosed with Alzheimer’s disease lives around 8 to 12 years after diagnoses (http://www.agingcare.com/Answers/How-long-does-Alzheimer-s-disease-last-on-average-133298.htm). <br><br> | We decided to research and to design primers that will help detect a specific SNP that causes Alzheimer’s disease. Alzheimer’s disease is a form of dementia that affects one in eight older Americans and is the sixth-leading cause of death in the United States (http://www.alz.org/alzheimers_disease_facts_and_figures.asp). It is usually present in people of 65 years of age and older, and causes cognitive deterioration ranging in severity and rate. The average person diagnosed with Alzheimer’s disease lives around 8 to 12 years after diagnoses (http://www.agingcare.com/Answers/How-long-does-Alzheimer-s-disease-last-on-average-133298.htm). <br><br> | ||
One of the SNP’s (single nucleotide polymorphism) associated with Alzheimer’s is Rs4934, located in chromosome 14, at position # 95,080,803. This missense mutation causes an allele change of '''G'''CT ⇒ '''A'''CT and is associated with the gene SERPINA3. People with this mutation have a 2.5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934 present in the OMIM database. | One of the SNP’s (single nucleotide polymorphism) associated with Alzheimer’s is Rs4934, located in chromosome 14, at position # 95,080,803. This missense mutation causes an allele change of '''G'''CT ⇒ '''A'''CT and is associated with the gene SERPINA3. People with this mutation have a 2.5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934 present in the OMIM database. | ||
<br><br> | <br><br>• Gene being affected: SERPINA3 <br> | ||
• SNP (Single Nucleotide Polymorphism): Rs4934<br> | |||
• Located in position # 95,080,803 <br> <br> | |||
'''DNA Sequence:'''<br> | |||
• '''5''''GAATGGAGAGAATGTTACCTCTCCTG'''[A/G]'''CTCTGGGGCTCTTGGCGGCTGGGTT'''3’''' <br> | |||
• '''3’'''CTTACCTCTCTTACAATGGAGAGGAC'''[T/C]'''GAGACCCCGAGAACCGCCGACCCAA'''5’'''<br><br> | |||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
Line 92: | Line 97: | ||
'''Primer Design'''<br> | '''Primer Design'''<br> | ||
• '''Forward Primer:'''<br> | |||
• | |||
• '''3’'''TGGAGAGGAC'''C'''GAGACCCCG'''5’'''<br><br> | • '''3’'''TGGAGAGGAC'''C'''GAGACCCCG'''5’'''<br><br> | ||
• Reverse Primer (150 basepairs to the left)<br> | • '''Reverse Primer (150 basepairs to the left)'''<br> | ||
• '''5’'''TGAGGGAGGC'''T'''CCAAAGCTA3’'''<br><br> | • '''5’'''TGAGGGAGGC'''T'''CCAAAGCTA3’'''<br><br> | ||
Revision as of 19:16, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.< Our design manipulates the 4x4 PCR Tube Block to a 3x7 block capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 test tube spaces will be inserted with a platinum temperature sensor. The platinum temperature sensor reads the temperature more accurately, and since it reads the temperature more accurately it saves more time.
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
Primer Design • Forward Primer:
Illustration
|