BME103:T930 Group 12 l2
From OpenWetWare
(→Research and Development) |
(→Research and Development) |
||
| Line 94: | Line 94: | ||
o '''3’'''TGGAGAGGAC'''C'''GAGACCCCG'''5’'''<br><br> | o '''3’'''TGGAGAGGAC'''C'''GAGACCCCG'''5’'''<br><br> | ||
• Reverse Primer (150 basepairs to the left)<br> | • Reverse Primer (150 basepairs to the left)<br> | ||
| - | o ''' | + | o '''5’'''TGAGGGAGGC'''T'''CCAAAGCTA3’'''<br><br> |
• Causes 2.5x increase risk of Alzheimer’s and decreased age at onset<br> | • Causes 2.5x increase risk of Alzheimer’s and decreased age at onset<br> | ||
| Line 107: | Line 107: | ||
• '''3’''' CTTACCTCTCTTACAATGGAGAGGAC'''[T/C]'''GAGACCCCGAGAACCGCCGACCCAA '''5’'''<br><br> | • '''3’''' CTTACCTCTCTTACAATGGAGAGGAC'''[T/C]'''GAGACCCCGAGAACCGCCGACCCAA '''5’'''<br><br> | ||
Forward Primer:<br> | Forward Primer:<br> | ||
| - | • '''3’'''TGGAGAGGAC'''C''GAGACCCCG'''5’'''<br> | + | • '''3’'''TGGAGAGGAC'''C'''GAGACCCCG'''5’'''<br> |
Reverse Primer (150 basepairs to the left):<br> | Reverse Primer (150 basepairs to the left):<br> | ||
• '''5’'''TGAGGGAGGC'''T'''CCAAAGCTA'''3’'''<br><br> | • '''5’'''TGAGGGAGGC'''T'''CCAAAGCTA'''3’'''<br><br> | ||
Revision as of 22:08, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||
| | |||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.< Our design manipulates the 4x4 PCR Tube Block to a 3x7 block capable of holding 21 DNA sample spaces instead of the generic 16. One of the 21 test tube spaces will be inserted with a platinum temperature sensor. The platinum temperature sensor reads the temperature more accurately, and since it reads the temperature more accurately it saves more time.
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
Primer Design
Surrounding sequence of Rs4934:
Illustration
| |||||||



