OUR TEAM
Name: Philip Remick Role(s)
|
| Name: Ryan Magnuson Role(s)
| Name: Nathan Moore Role(s)
| Name: Divya Amrelia Role(s)
|
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design
The Open PCR(polymerase chain reaction) machine cycles samples of DNA through different temperatures. DNA samples are placed in the 16 tube PCR block and the PCR is set to a certain number of temperatures and cycles.
Experimenting With the Connections
When we unplugged the LCD plate from the Open PCR circuit board, the display of the machine turned off (since it stopped sending data to the display). The circuit board sends electricity through the wires, therefore if the LCD plate is not plugged into the circuit board, it will not work.
When we unplugged the white wire that connects the Open PCR circuit board to the 16 tube PCR block, the machine could not record the temperature. This defeats the whole purpose of the machine since it needs to heat the tubes to the specific temperatures.
Test Run
On October 25, 2012, we experimented with the Open PCR. The experience was not pleasant as the machine took an hour and forty minutes to finish the experiment. The time estimate was also incorrect as it fluctuated. Fortunately, the experiment was a success as the machine finished the testing, revealing whether the DNA contained mutations.
(Write the date you first tested Open PCR and your experience(s) with the machine)
Protocols
Polymerase Chain Reaction
The process of the polymerase chain reaction (PCR) is used to amplify specific sequences of DNA and create thousands to millions of copies. The process depends on thermal cycling, which continually heat and cool the samples in order for DNA polymerase and primers to effectively replicate the specific DNA.
| Components of PCR
|
| 1. GoTaq® Colorless Master Mix 2X
|
| 2. Upstream primer 10μM
|
| 3. Downstream primer 10μM
|
| 4. DNA template
|
| 5. 400μM
dATP
|
| 6. 400μM
dGTP
|
| 7. 400μM
dCTP
|
| 8. 400μM
dTTP
|
| 9. 3mM MgCl2
|
| Reagent
| Volume
|
| Template DNA (20 ng)
| 0.2 μL
|
| 10 μM forward primer
| 1.0 μL
|
| 10 μM reverse primer
| 1.0 μL
|
| GoTaq master mix
| 50.0 μL
|
| dH20
| 47.8 μL
|
| Total Volume
| 100.0 μL
|
Male Patients: Test Tubes: 1-3
Female Patients: Test Tubes: 4-6
Cancer DNA Template: Test Tube: 7
Negative Control: Test Tube: 8
The Steps:
1. Label DNA Samples.
2. Use the micro-pipetter and transfer forward primers, reverse primers, Taq polymerase, and dNTP to each of the 8 labeled samples. Replace tip of pipetter to avoid contamination.
3. Place samples into Open PCR machine.
4. Close lid and tighten.
5. Run the machine to the following settings:
- Stage One: 1 cycle, 95 degrees Celsius for 3 minutes
- Stage Two: 35 cycles, 95 degrees for 30 seconds, 57 degrees for 30 seconds, 72 degrees for 30 seconds
- Stage Three: 72 degrees for 3 minutes
- Final Hold: 4 degrees Celsius
Fluorimeter
Set Up
The Steps:
1. Open up the fluorimeter box and remove the contents.
2. Disassemble the box by unsnapping it.
3. Put the cover of the box on the bottom facing upside down.
4. Next, place the fluorimeter on top of the box cover.
5. Then, carefully add the glass slide in between the fluorimeter.
6. Use the pipet and remove about .25ml of the sample or water.
7. Place a few drops of the substance in the middle of the slots until they conjoin.
8. Turn on the LED light.
9. Make sure the LED is going through the center of the drops, a cone of light should go around it, however, not at an angle.
10. Carefully place the cell phone stand in front of the fluorimeter.
11. Configure the cell phone by going to the camera menu and doing the following:
- Inactivate the flash
- Set ISO to 800 (or higher)
- Set white balance to auto
- Set exposure to highest setting
- Set saturation to the highest setting
- Set contrast to the lowest setting
- Set the timer for five seconds
12. Place the cell phone on the stand and take the picture while placing the cover over the fluorimeter.
13. Repeat steps 5-12 as necessary.
The Steps for Image J:
1. Download the Image J software.
2. Save the pictures to smart phone.
3. Be sure to name the pictures in the correct order taken in order to separate the images.
3. Download the pictures onto a computer that has Image J through a USB device or uploading them.
4. Open them with Image J by going to add image. Find image on the files.
5. Edit the picture:
- Use the menu selection analyze>set measurements and choose 'area integrated density' and 'mean grey value'.
- Use the green image.
- Click on the menu bar to activate the oval selection.
- Draw the best oval around your green drop image and then select 'analyze>measure.'
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
PCR or polymerase chain reactions are used to identify genes by making copies of specific DNA sequences and amplifying the reactions. There are a variety of applications for PCR including DNA cloning, the diagnosis of hereditary diseases, and the identification of genetic fingerprints. In this case, PCR was used to diagnose a gene known to predict certain hereditary diseases. PCR uses thermal cycling in which the DNA is amplified, generating thousands to millions of copies of the particular gene. Before the process is described, here is some terminology to know:
•Template DNA- the sequence being detected.
•Primers- Initiate the start site for DNA replication.
•Taq polymerase- an enzyme that grabs bases, and matches them to the DNA strand, replicating the strand.
•Magnesium Chloride (MgCl2)- a cofactor that binds to Taq and helps it work more efficiently.
• dNTP’s -the individual nucleotides floating in the sample tube that will act as building block subunits to be used by the Taq.
The process is as follows:
•The sample is heated to 95 degrees Celsius to separate strands and expose the bases.
•The primers are added to the sample and it is cooled to 57 degrees Celsius so that the separated DNA strands try to reconnect. The primers will bind to the strands in the phase preventing them from reconnecting.
•The sample is then heated to 72 degrees Celsius and Taq enzymes attach and start replication, with the help of magnesium chloride to help the enzymes work more efficiently.
•The cycle is repeated many times
Here are step-by-step illustrations of how the primer binds to the wanted DNA template, and how the Taq polymerase amplifies the DNA:
A description of the image goes here
A description of the image goes here
A description of the image goes here
A description of the image goes here
Images from (http://openpcr.org/use-it/)
The r17879961 sample is a cancer causing polymorphism prevalent in homo sapiens. It is located in chromosome 22 and is identified by an allele change of ATT → ACT. This missense causes a residue change of I [Ile] ⇒ T [Thr]. Here is the sequence surrounding the mutation:
5' AACTCTTACAC/TTGCATACAT 3'
3' TTGAGAATGTG/AACGTATGTA 5'
To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5' AACTCTTACACTGCATACAT 3', and the forward primer would be 3' TGGTATAAGACATTCCTGT 5'. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers won’t bind to the gene.
To identify whether the samples being tested are positive or negative, a green fluorescent dye was used . Each sample, along with a couple drops of Sybr green indicator were placed on a slide. The slide was placed in a dark box and a picture was taken of each sample. The pictures were then analyzed using a software program, which was able to determine the positive samples based on the amount of fluorescence in each sample.
Bayes Rule
Bayes rule is a statistical theorem that utilizes all available data to help account for false positives and negatives in diagnostic tests. In this case, Bayes rule will be used to determine the probability of a positive test result when cancer is present. The equation for the Bayes theorem is:
p(C/T)= [p(T/C)*p(C)]/[{p(T/C)*p(C)}+{p(T/~C)*p(~C)}]
The affected gene is checkpoint kinase 2, and in a study of 180 patients the mutation has been shown to occur in 1.1% of population, while the normal gene occurs in 98.9% of the population. The mutations have been linked most closely to prostate and colorectal cancer, but are also associated with Li-Fraumeni syndrome, breast cancer, sarcomas, and brain tumors. According to a study in Finland, the gene was observed in 7.8% of patients with colorectal cancer, and 5.3% of the healthy population (Kilpivaara et al., 2006).
Results
| Sample | Integrated Density | DNA μg/mL | Conclusion
|
| PCR: Negative Control | 59029706 | none | no signal
|
| PCR: Positive Control | 103221738 | 2.0 | positive
|
| PCR: Patient 1 ID 85002, rep 1 | 68983895 | 1.621445055
| no signal
|
| PCR: Patient 1 ID 85002, rep 2 | 161582057 | 2.835324583
| positive
|
| PCR: Patient 1 ID 85002, rep 3 | 339095 | 1.894869599
| no signal
|
| PCR: Patient 2 ID 34994, rep 1 | 26308876 | 0.7226598225844 | no signal
|
| PCR: Patient 2 ID 34994, rep 2 | 36927888 | 1.014345918
| no signal
|
| PCR: Patient 2 ID 34994, rep 3 | 34338469 | 0.943210077487 | no signal
|
KEY
- Sample = a small piece of information on the research area. In this experiment, the samples are the DNA of two patients. A positive and negative sample were also given to compare the data collected from the DNA of the patients.
- Integrated Density = the sum of the values of pixels in an image. A software was provided that gave the summation of the pixels of the image uploaded.
- DNA μg/mL = the DNA concentration (micro grams per ml). An equation was given to find the concentration. The equation was x=(2*y)/z. x=concentration, y=INTDEN of sample (with background subtracted), z=INTDEN of DNA Calf Thymus (with background subtracted)
- Conclusion = states whether the patient contains the cancer gene sequence. A positive conclusion means he does while no signal states he does not. The conclusion was based off of the DNA concentrations of the positive and negative samples.
|