BME103:T930 Group 12: Difference between revisions
(14 intermediate revisions by 3 users not shown) | |||
Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| [[Image:BME103student.jpg|100px|thumb| | | [[Image:BME103student.jpg|100px|thumb| Philip Remick <br>]] | ||
| [[Image:BME103student.jpg|100px|thumb| | | [[Image:BME103student.jpg|100px|thumb| David Tze<br>]] | ||
| [[Image:BME103student.jpg|100px|thumb| | | [[Image:BME103student.jpg|100px|thumb| Ryan Magnuson<br>]] | ||
| [[Image:BME103student.jpg|100px|thumb| | | [[Image:BME103student.jpg|100px|thumb| Nathan Moore <br>]] | ||
| [[Image:BME103student.jpg|100px|thumb| | | [[Image:BME103student.jpg|100px|thumb| Divya Amrelia <br>]] | ||
|} | |} | ||
Line 26: | Line 26: | ||
'''The Original Design'''<br> | '''The Original Design'''<br> | ||
[[Image:Group 12 PCR Image.png]] | |||
[[Image: | |||
The Open PCR(polymerase chain reaction) machine cycles samples of DNA through different temperatures. DNA | '''Description'''<br> | ||
The Open PCR(polymerase chain reaction) machine cycles samples of DNA through different temperatures with the purpose of replicating the DNA. The machine cycles through different temperatures to denature, anneal, and extend the DNA. At a high temperature, DNA denatures, meaning the DNA separates into two single strands. Then primers bind to the two separate strands to prevent them from joining back together and the sample is cooled. Finally, the DNA sample is heated once more and enzymes (Taq Polymerase) attach to the separated strands and begin replication. | |||
'''Experimenting With the Connections'''<br> | '''Experimenting With the Connections'''<br> | ||
Line 41: | Line 41: | ||
On October 25, 2012, we experimented with the Open PCR. The experience was not pleasant as the machine took an hour and forty minutes to finish the experiment. The time estimate was also incorrect as it fluctuated. Fortunately, the experiment was a success as the machine finished the testing, revealing whether the DNA contained mutations. | On October 25, 2012, we experimented with the Open PCR. The experience was not pleasant as the machine took an hour and forty minutes to finish the experiment. The time estimate was also incorrect as it fluctuated. Fortunately, the experiment was a success as the machine finished the testing, revealing whether the DNA contained mutations. | ||
Line 146: | Line 145: | ||
*Set saturation to the highest setting | *Set saturation to the highest setting | ||
*Set contrast to the lowest setting | *Set contrast to the lowest setting | ||
*Set the timer for five seconds | |||
12. Place the cell phone on the stand and take the picture while placing the cover over the fluorimeter.<br> | |||
13. Repeat steps 5-12 as necessary.<br> | |||
<br> | |||
''The Steps for Image J:''<br> | |||
1. Download the Image J software.<br> | |||
2. Save the pictures to smart phone.<br> | |||
3. Be sure to name the pictures in the correct order taken in order to separate the images.<br> | |||
3. Download the pictures onto a computer that has Image J through a USB device or uploading them.<br> | |||
4. Open them with Image J by going to add image. Find image on the files.<br> | |||
5. Edit the picture: | |||
*Use the menu selection analyze>set measurements and choose 'area integrated density' and 'mean grey value'. | |||
*Use the green image. | |||
*Click on the menu bar to activate the oval selection. | |||
*Draw the best oval around your green drop image and then select 'analyze>measure'. | |||
*Write down the sample number and numbers measured. | |||
*Draw another oval for the of the same size in the green file for the background about the drop to get the "noise". Select 'analyze>measure'. Write drown the sample number and the numbers measure and label this as background. Save your measurements. | |||
[[Image:Green Drop.png]] | |||
<br> | |||
Sample of the image from a smart phone showing the DNA amplified sample (green) in the fluorimeter.<br> | |||
<br><br> | <br><br> | ||
Line 178: | Line 195: | ||
Here are step-by-step illustrations of how the primer binds to the wanted DNA template, and how the Taq polymerase amplifies the DNA: <br> | Here are step-by-step illustrations of how the primer binds to the wanted DNA template, and how the Taq polymerase amplifies the DNA: <br> | ||
[[Image:BME103-12-1.png|thumb|frame|left| | [[Image:BME103-12-1.png|thumb|frame|left|]] | ||
[[Image:BME103-12-2.png|thumb|frame|left| | [[Image:BME103-12-2.png|thumb|frame|left|]] | ||
[[Image:BME-12-3.png|thumb|frame|left| | [[Image:BME-12-3.png|thumb|frame|left|]] | ||
[[Image:BME-12-4.png|thumb|frame|left| | [[Image:BME-12-4.png|thumb|frame|left|]] | ||
Images from (http://openpcr.org/use-it/) <br><br> | Images from (http://openpcr.org/use-it/) <br><br> | ||
The r17879961 sample is a cancer causing polymorphism prevalent in homo sapiens. It is located in chromosome 22 and is identified by an allele change of ATT → ACT. This missense causes a residue change of I [Ile] ⇒ T [Thr]. Here is the sequence surrounding the mutation: <br> | The r17879961 sample is a cancer causing polymorphism prevalent in homo sapiens. It is located in chromosome 22 and is identified by an allele change of ATT → ACT. This missense causes a residue change of I [Ile] ⇒ T [Thr]. Here is the sequence surrounding the mutation: <br> |
Latest revision as of 00:57, 15 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingDescription Experimenting With the Connections When we unplugged the LCD plate from the Open PCR circuit board, the display of the machine turned off (since it stopped sending data to the display). The circuit board sends electricity through the wires, therefore if the LCD plate is not plugged into the circuit board, it will not work. When we unplugged the white wire that connects the Open PCR circuit board to the 16 tube PCR block, the machine could not record the temperature. This defeats the whole purpose of the machine since it needs to heat the tubes to the specific temperatures.
On October 25, 2012, we experimented with the Open PCR. The experience was not pleasant as the machine took an hour and forty minutes to finish the experiment. The time estimate was also incorrect as it fluctuated. Fortunately, the experiment was a success as the machine finished the testing, revealing whether the DNA contained mutations.
ProtocolsPolymerase Chain Reaction The process of the polymerase chain reaction (PCR) is used to amplify specific sequences of DNA and create thousands to millions of copies. The process depends on thermal cycling, which continually heat and cool the samples in order for DNA polymerase and primers to effectively replicate the specific DNA.
Male Patients: Test Tubes: 1-3
Female Patients: Test Tubes: 4-6
Cancer DNA Template: Test Tube: 7 Negative Control: Test Tube: 8 The Steps:
Fluorimeter
12. Place the cell phone on the stand and take the picture while placing the cover over the fluorimeter.
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology •Template DNA- the sequence being detected. •Primers- Initiate the start site for DNA replication. •Taq polymerase- an enzyme that grabs bases, and matches them to the DNA strand, replicating the strand. •Magnesium Chloride (MgCl2)- a cofactor that binds to Taq and helps it work more efficiently. • dNTP’s -the individual nucleotides floating in the sample tube that will act as building block subunits to be used by the Taq. The process is as follows: •The sample is heated to 95 degrees Celsius to separate strands and expose the bases. •The primers are added to the sample and it is cooled to 57 degrees Celsius so that the separated DNA strands try to reconnect. The primers will bind to the strands in the phase preventing them from reconnecting. •The sample is then heated to 72 degrees Celsius and Taq enzymes attach and start replication, with the help of magnesium chloride to help the enzymes work more efficiently. •The cycle is repeated many times Here are step-by-step illustrations of how the primer binds to the wanted DNA template, and how the Taq polymerase amplifies the DNA: Images from (http://openpcr.org/use-it/) 5' AACTCTTACAC/TTGCATACAT 3' 3' TTGAGAATGTG/AACGTATGTA 5' To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5' AACTCTTACACTGCATACAT 3', and the forward primer would be 3' TGGTATAAGACATTCCTGT 5'. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers won’t bind to the gene. Bayes Rule The affected gene is checkpoint kinase 2, and in a study of 180 patients the mutation has been shown to occur in 1.1% of population, while the normal gene occurs in 98.9% of the population. The mutations have been linked most closely to prostate and colorectal cancer, but are also associated with Li-Fraumeni syndrome, breast cancer, sarcomas, and brain tumors. According to a study in Finland, the gene was observed in 7.8% of patients with colorectal cancer, and 5.3% of the healthy population (Kilpivaara et al., 2006). Results
|