BME103:T930 Group 12: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Line 68: | Line 68: | ||
<br><br> | <br><br> | ||
PCR or polymerase chain reactions are used to identify genes by making copies of specific DNA sequences and amplifying the reactions. There are a variety of applications for PCR including DNA cloning, the diagnosis of hereditary diseases, and the identification of genetic fingerprints. In this case, PCR was used to diagnose a gene known to predict a certain hereditary disease. PCR uses thermal cycling in which the DNA is amplified, generating thousands to millions of copies of the particular gene. <br>Before the process is described, here is some terminology to know. <br> | PCR or polymerase chain reactions are used to identify genes by making copies of specific DNA sequences and amplifying the reactions. There are a variety of applications for PCR including DNA cloning, the diagnosis of hereditary diseases, and the identification of genetic fingerprints. In this case, PCR was used to diagnose a gene known to predict a certain hereditary disease. PCR uses thermal cycling in which the DNA is amplified, generating thousands to millions of copies of the particular gene. <br>Before the process is described, here is some terminology to know. <br> | ||
•Template DNA- the sequence being detected. <br> | •Template DNA- the sequence being detected. <br> | ||
•Primers- Initiate the start site for DNA replication. <br> | •Primers- Initiate the start site for DNA replication. <br> | ||
Line 85: | Line 85: | ||
TTGAGAATGT'''G/A'''ACGTATGTA <br> | TTGAGAATGT'''G/A'''ACGTATGTA <br> | ||
To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer is going to be AACTCTTACACTGCATACAT, and the forward primer is going be TGGTATAAGACATTCCTGT, located 200 base pairs to the left and would attach to the opposite strand as the reverse primer. The strand needs to be at least 200 base pairs long so that it can be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies, since the primers won’t bind to the gene. A green fluorescent dye is usually used to identify whether or not the sample is positive or negative. <br> | To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer is going to be AACTCTTACACTGCATACAT, and the forward primer is going be TGGTATAAGACATTCCTGT, located 200 base pairs to the left and would attach to the opposite strand as the reverse primer. The strand needs to be at least 200 base pairs long so that it can be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies, since the primers won’t bind to the gene. A green fluorescent dye is usually used to identify whether or not the sample is positive or negative. <br> | ||
The affected gene is checkpoint kinase 2, and in a study of 180 patients the mutation has been shown to occur in 1.1% of population, while the normal gene occurs in 98.9% of the population. The mutations have been linked most closely to prostate and colorectal cancer, but are also associated with Li-Fraumeni syndrome, breast cancer, sarcomas, and brain tumors. According to a study in Finland, the gene was observed in 7.8% of patients with colorectal cancer, and 5.3% of the healthy population (Kilpivaara et al., 2006). | The affected gene is checkpoint kinase 2, and in a study of 180 patients the mutation has been shown to occur in 1.1% of population, while the normal gene occurs in 98.9% of the population. The mutations have been linked most closely to prostate and colorectal cancer, but are also associated with Li-Fraumeni syndrome, breast cancer, sarcomas, and brain tumors. According to a study in Finland, the gene was observed in 7.8% of patients with colorectal cancer, and 5.3% of the healthy population (Kilpivaara et al., 2006). | ||
==Results== | ==Results== |
Revision as of 21:57, 7 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help |
OUR TEAM |