BME103:T930 Group 11 l2: Difference between revisions
(54 intermediate revisions by 6 users not shown) | |||
Line 9: | Line 9: | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
=OUR TEAM= | =OUR TEAM: Group 11= | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- | ||
| [[Image: | | [[Image:Joey.jpg|100px|thumb|Name: Benjamin Hook<br>Protocol]] | ||
| [[Image: | | [[Image:Chandler.jpg|100px|thumb|Name: Jacqueline Janssen<br>Protocol]] | ||
| [[Image: | | [[Image:rachel.jpg|100px|thumb|Name: Samantha Boccasini<br>Open PCR machine engineer]] | ||
| [[Image: | | [[Image:Friends Ross.jpg|100px|thumb|Name: Tony Nguyen<br>R&D]] | ||
| [[Image: | | [[Image:Pheobe.jpg|100px|thumb|Name: Ryelle Pattuinan<br>R&D]] | ||
| [[Image:Monica.jpg|100px|thumb|Name: Kenze Caulfield<br>Open PCR machine engineer]] | |||
|} | |} | ||
Line 25: | Line 26: | ||
==Thermal Cycler Engineering== | ==Thermal Cycler Engineering== | ||
'''System Design'''<br> | |||
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski. Our new design incorporates some new designs such as software, screen zize, number of testing tube lots, as well as size of heating lid. All of these alterations are made to make the Open PCR system more efficient in terms of its operating system and user-friendly features.<br> | |||
Line 34: | Line 35: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
Our most major change to the Open PCR System is the change we made to the read-out screen on the top of the device near the heating lid. This change actually affects a few major components of our system. Not only did we move the screen to the side of the machine, rather than the top, but we also optimized the size of it. This size-change allows users to see the read-outs clearer. We also eliminated the need for a computer (or any outside device, that is) as this new larger screen will also be able to control the machine. Now the user is able to input cycles, temperature, etc. right on the screen instead of needing to plug it into a separate system. This allows for better portability and easier use. | |||
We also changed the space of the testing tubes so now more tubes can be tested at once. To do this we lengthened the plate as well as the heating lid entirely across the top of the machine. Removing the screen from this part of the Open PCR System also allowed for this change. | |||
[[Image:Open_pcr_copy.jpg]] | |||
[[Image:Open_pcr_2_copy.jpg]] | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
The same type of instructions to setting up the original PCR machine apply to this one; however, running the cycles will be quite different. There will no longer be a USB drive or cord that connect to a laptop. Now the actual readings and programs will all be on the touch-screen. So now you will be able to set up the machine very similarly as before except everything will be on the screen. The idea for the new PCR machine is to be more mobile and accessible to users. Setting up the cycling will all be the same with the same options as well, so there will not be any huge differences other than it will be less worry about connection to the laptop, which in turn equally reduces worry about portability. | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Line 78: | Line 85: | ||
|- | |- | ||
|(8) Glass Slides | |(8) Glass Slides | ||
|- | |||
|SYBR Green (200 mL) | |||
|- | |||
|Measurement Buffer (800 mL) | |||
|- | |||
|Black Box | |||
|- | |||
|Positive Sample (50 mL) | |||
|- | |||
|Eppendorf Tubes (40) | |||
|- | |- | ||
|} | |} | ||
Line 92: | Line 109: | ||
|- | |- | ||
| Negative Control DNA Solution | | Negative Control DNA Solution | ||
|- | |||
|1 Smartphone | |||
|- | |||
| Pair of Gloves | |||
|- | |||
| 1 Lab Coat | |||
|- | |||
|Water Sample | |||
|- | |- | ||
|} | |} | ||
{| border="1" style="border-collapse:collapse;" style="margin: 1em auto 1em auto;" | {| border="1" style="border-collapse:collapse;" style="margin: 1em auto 1em auto;" | ||
Line 112: | Line 136: | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
<br>Step 1: | <br>Step 1: Download the Open PCR Software onto Computer | ||
<br>Step 2: Open | <br>Step 2: Plug in and turn on the Open PCR machine, connect the USB cable to your computer | ||
<br>Step | <br>Step 3: On the machine interface, select "DNA replication" and then choose desired number of cycles (at least 30 for quality results). | ||
<br>Step | <br>Step 4: Using the Pipette, transfer 30 samples of the patients DNA into each test tube. You should only use 1 Pipette tip for this part of the process. Also transfer the positive and negative control into separate test tubes. | ||
<br>Step 5: Next, transfer the forward and reverse primers into each of the 32 test tubes. 2 Pipette tips should be used in this part of the process: 1 for all of the forward primer transfers, and 1 for all of the reverse primer transfers. | |||
<br>Step 6: Using a new pipette tip, transfer the GoTaq Master mix into each of the 32 test tubes. | |||
<br>Step 7: Dilute the 32 solutions by filling the remainder of the test tube with distilled water. | |||
<br>Step 8: Carefully Label Each test tube with a sharpie making sure that the positive and negative controls are clearly marked. | |||
<br>Step 9: Open the heated lid of the Open PCR machine and place the test tubes into the designated slots. Close the lid. | |||
<br>Step 10: Make sure everything is properly connected and then choose "begin replication" on the interface. | |||
<br>Step 11: Check to make sure that the computer is correctly receiving the information, if not: stop the cycle, check the USB cord, and try again. | |||
'''DNA Measurement Protocol''' | '''DNA Measurement Protocol''' | ||
<br>Step 1: When replicating is finished, remove the 32 tubes from the PCR Machine, as well as the positive and negative controls. | |||
<br>Step 2: Transfer DNA samples to eppendorf tube containing 800 mL of buffer. Use a new tip on the pipette for each transfer of DNA to avoid contamination. Do the same for all the controls. | |||
<br>Step 3: Using the rough side of the slides, place two drops over two holes on the slide of SYBR green. Carefully, using a new tip of a pipette, transfer two drops of a DNA sample on the SYBR green. | |||
<br>Step 4: Place the slide in the black box directly in the ray of the light. | |||
<br>Step 5: Take a photo of the slide using the smart phone. | |||
<br>Step 6: Using a new pipette tip that is marked for waste, remove the sample from the slide and dispose of it. | |||
<br>Step 7: Repeat steps 3-6 using a new pipette tip for each new sample or control. | |||
<br>Step 8: Analyze the results, knowing that the samples that glow green are the positive ones. | |||
==Research and Development== | ==Research and Development== | ||
Line 129: | Line 168: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
Prostate Cancer: androgen receptor | |||
"Prostate Cancer is cancer that starts in the prostate gland. The prostate is a small walnut-sized structure that makes up part of a man's reproductive system. It wraps around the urethra, the tube that carries urine out of the body."[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] Prostate Cancer is the most common cause of death from cancer in men over age 75. It's very rare to find it in men younger than 40. In fact, the most common problem in almost all men as they grow older is an enlarged prostate. More information can be found regarding Prostate cancer is here.[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/] | |||
An image of a normal prostate and cancer prostate[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001418/figure/A000380.B18038/?report=objectonly] | |||
The marker that is being use was rs137852593.[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=137852593] | |||
The Dna Sequence is CTCTGCCTCTTCTTCTCCAGGCTTCC[G/T]CAACTTACACGTGGACGACCAGATG[http://www.ncbi.nlm.nih.gov/snp/?term=rs137852593&SITE=NcbiHome&submit=Go] and found in chromosome 13. | |||
Retinoblastoma 1 | |||
Retinoblastoma is a rare, cancerous tumor of a part of the eye called the retina. The disease is caused by a mutation in a gene controlling cell division, causing cells to grow out of control and become cancerous. The cancer generally affects children under the age of 6. It is most commonly diagnosed in children aged 1-2 years. The information regarding this disease is here.[http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0002025/] | |||
An image of the eye is here. [http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0002025/figure/A001030.B1094/?report=objectonly] | |||
The marker that is being use is rs121913297. [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121913297] | |||
The DNA sequence is TCAAACGTGTTTTGATCAAAGAAGAG[G/T]AGTATGATTCTATTATAGTATTCTA | |||
[http://www.ncbi.nlm.nih.gov/snp?term=121913297] and found in chromosome 13. | |||
'''Primer Design''' | '''Primer Design''' | ||
'''''Retinoblastoma''''' | |||
Forward Primer: '''5'''' ATCAAAGAAGAG'''T'''AGTATGA '''3'''' | |||
There is a mutation from a G to a T | |||
Reverse Primer: '''3'''' TAGTTTCTTCTC'''A'''TCATACT '''5'''' | |||
'''''Prostate Cancer''''' | |||
Forward Primer: '''5'''' AGGCTTCC'''T'''CAACTTACACG '''3'''' | |||
There is a mutation from a G to a T | |||
Reverse Primer: '''3'''' TCCGAAGG'''A'''GTTGAATGTGC '''5'''' | |||
If the sample carries the mutation, then the sample would test positive. If it does not, then the sample would test negative because the primers would not be able to bind to the DNA because it does not contain the proper sequence. | |||
'''Illustration''' | '''Illustration''' | ||
These are the primers for the Retinoblastoma sample binding: | |||
[[Image:Retinoblastoma.jpg]] | |||
These are the primers for the Prostate Cancer sample binding: | |||
[[Image:Prostate Cancer.jpg]] | |||
This is the process of DNA amplification: | |||
http://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif | |||
[http://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif] | |||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:bayes.jpg]] | |||
<math>P(A|B) = \frac{P(B | A)\, P(A)}{P(B)}. \,</math><br> | |||
<math> P(A|B) </math> represents the probability that cancer will produce a positive outcome in the test (when the primer binds to the mutated gene). | |||
<math> P(B|A) </math> represents the probability a person will yield a positive result for the cancer test. | |||
<math> P(A) </math> represents the probability of carrying the mutated gene. | |||
<math> P(B) </math>represents the probability of people who would yield a positive result in the test without really having cancer. | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Latest revision as of 13:33, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||
OUR TEAM: Group 11LAB 2 WRITE-UPThermal Cycler EngineeringSystem Design Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. Our new design incorporates some new designs such as software, screen zize, number of testing tube lots, as well as size of heating lid. All of these alterations are made to make the Open PCR system more efficient in terms of its operating system and user-friendly features.
Our most major change to the Open PCR System is the change we made to the read-out screen on the top of the device near the heating lid. This change actually affects a few major components of our system. Not only did we move the screen to the side of the machine, rather than the top, but we also optimized the size of it. This size-change allows users to see the read-outs clearer. We also eliminated the need for a computer (or any outside device, that is) as this new larger screen will also be able to control the machine. Now the user is able to input cycles, temperature, etc. right on the screen instead of needing to plug it into a separate system. This allows for better portability and easier use. We also changed the space of the testing tubes so now more tubes can be tested at once. To do this we lengthened the plate as well as the heating lid entirely across the top of the machine. Removing the screen from this part of the Open PCR System also allowed for this change. Instructions
ProtocolsMaterials
PCR Protocol
DNA Measurement Protocol
Research and DevelopmentBackground on Disease Markers Prostate Cancer: androgen receptor "Prostate Cancer is cancer that starts in the prostate gland. The prostate is a small walnut-sized structure that makes up part of a man's reproductive system. It wraps around the urethra, the tube that carries urine out of the body."[1] Prostate Cancer is the most common cause of death from cancer in men over age 75. It's very rare to find it in men younger than 40. In fact, the most common problem in almost all men as they grow older is an enlarged prostate. More information can be found regarding Prostate cancer is here.[2] An image of a normal prostate and cancer prostate[3] The marker that is being use was rs137852593.[4] The Dna Sequence is CTCTGCCTCTTCTTCTCCAGGCTTCC[G/T]CAACTTACACGTGGACGACCAGATG[5] and found in chromosome 13.
Retinoblastoma is a rare, cancerous tumor of a part of the eye called the retina. The disease is caused by a mutation in a gene controlling cell division, causing cells to grow out of control and become cancerous. The cancer generally affects children under the age of 6. It is most commonly diagnosed in children aged 1-2 years. The information regarding this disease is here.[6] An image of the eye is here. [7] The marker that is being use is rs121913297. [8] The DNA sequence is TCAAACGTGTTTTGATCAAAGAAGAG[G/T]AGTATGATTCTATTATAGTATTCTA [9] and found in chromosome 13. Primer Design Retinoblastoma Forward Primer: 5' ATCAAAGAAGAGTAGTATGA 3' There is a mutation from a G to a T Reverse Primer: 3' TAGTTTCTTCTCATCATACT 5' Prostate Cancer Forward Primer: 5' AGGCTTCCTCAACTTACACG 3' There is a mutation from a G to a T Reverse Primer: 3' TCCGAAGGAGTTGAATGTGC 5' If the sample carries the mutation, then the sample would test positive. If it does not, then the sample would test negative because the primers would not be able to bind to the DNA because it does not contain the proper sequence.
These are the primers for the Retinoblastoma sample binding: These are the primers for the Prostate Cancer sample binding: This is the process of DNA amplification: http://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif [10]
[math]\displaystyle{ P(A|B) = \frac{P(B | A)\, P(A)}{P(B)}. \, }[/math] [math]\displaystyle{ P(A|B) }[/math] represents the probability that cancer will produce a positive outcome in the test (when the primer binds to the mutated gene). [math]\displaystyle{ P(B|A) }[/math] represents the probability a person will yield a positive result for the cancer test. [math]\displaystyle{ P(A) }[/math] represents the probability of carrying the mutated gene. [math]\displaystyle{ P(B) }[/math]represents the probability of people who would yield a positive result in the test without really having cancer.
|