BME103:T930 Group 10: Difference between revisions
Mikayle Holm (talk | contribs) |
Mikayle Holm (talk | contribs) |
||
Line 127: | Line 127: | ||
'''Flourimeter Measurements'''<br> | '''Flourimeter Measurements'''<br> | ||
[[Image:BME. | [[Image:BME.jpg|200px|Fluorimeter set up]] | ||
<br><br> | <br><br> |
Revision as of 11:29, 8 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP(Please finish by 11/7/2012) Initial Machine Testing
When we unplugged the circuit board from the mounting plate, the LED display on the PCR machine stopped functioning. When we unplugged the white wire that connects the Open PCR circuit board to the heating plate, the temperature recordings that were displayed on the LED display stopped functioning.
(Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction Polymerase Chain Reaction (PCR) is a technique used to amplify fragments of DNA. This allows researchers to see the base sequence of the DNA. It works by the DNA polymerase enzyme synthesizes a complementary strand of the fragmented DNA when mixed with primers that signal where the DNA sequencing should begin. When the DNA polymerase enzyme, MgCL2, dNTP’s, forward primer, and reverse primers are all added to the test tubes and placed in the PCR machine, the mixture is first heated to separate the double helix, then cooled to allow the primers to bind. After the primers bind, the polymerase completes the new complementary strands. The PCR machine then repeats heating and cooling cycles to multiply the fragmented DNA. After a couple hours, the now amplified segments of DNA can be analyzed to test for a cancer marker. Procedure: The PCR (GoTaq) Master Mix is advertised as a “ready-to-use solution” and it contains the Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers. These substances are mixed at proper concentrations so the user can achieve a useable amplification of DNA segments by PCR.
Samples Flourimeter Measurements
Fluorimeter assembly procedure- Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while still being able to use the smart phone to take pictures.
How to open images in Image J- Save the pictures to the phone. Download the pictures onto a computer that has Image J. Open them with Image J by going to add image. Sample Procedure: Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The DNA sequence r17879961 is the cancer-associated sequence for Colon Rectal Cancer. The goal of this experiment was to detect a cancer-associated sequence in a PCR machine and through the detection method. PCR stands for polymerase chain reaction, a method that uses DNA polymerase and primers, small sets of DNA, to amplify a sample of DNA to study and see specific sequences in it. Through thermal cycling, DNA sequences are melted apart from their complimentary base pairs and then cooled to allow primers to connect to the open DNA sequences. This process is repeated again and again to get many copies of the specific DNA strand. In this experiment, the reverse primers used will be in the sequence of AAACTCTTACACTGCATACA and that will accompany to the TTTGAGAATGTGACGTATGT which is the sequence of Colon rectal cancer that is being studied. This occurs on the 22nd chromosome and the missense of the disease comes when the sequence AATGT has the T in the middle is changed to a C which is cancer associated and creates a Protein Change to occur. In this experiment, this sequence will be put in with the reverse primer sequence listed above. Through the PCR process, the primer will attach to the sequence and replicate the DNA sequence. If the cancer sequence is present, the primers will attach and replicate until there are numerous samples of the cancer sequence. If there is no cancer sequence present, the primers will not bond since the sequence will be different and the ending DNA sequence will be the same as the original sequence put in. This will provide a correct detection for the r17879961 SNP. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results(Your group will add the results of your Fluorimeter measurements from Week 4 here)
|