OUR TEAM
Name:Luke Lammes Protocol PLanners
| Name: Daniel Saman Machine Engineer
| Name: Bryce Munter R & D Scientist
| Name: David Probst R&D Scientist
| Name: Adrian Munoz Machine Engineer
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
One of our re-designs is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
These are components of the OpenPCR that we are going to be modifying. The
top cover,circuit board and LCD.
Our modification to the OpenPCR is a simple yet effective way to make the OpenPCR more user friendly. We have lengthened the top cover to make room for a number pad. The LCD's size has been increased to allow more onscreen options. The circuit board has been fitted with a micro processor to help speed up simple tasks and allow the keypad to work. These modifications to the OpenPCR allow for the machine to be used without an external computer or computing device. Without an extra machine needed to run the PCR, we have made the machine even more simple. The key pad will be designed around the idea of a microwave, allowing for the user to input the cycles and times directly from the PCR itself. The LCD has been enlarged to cope with the new set of options made available with the keypad. We also added a microprocessor to the machine that would help with simple calculations. The microprocessor will also allow for the use of the keypad without any delay.
Installing the new modifications is a simple task as not much has changed and only one thing has been added.
1. Attach keypad to the extended portion of the top cover with the included screws.
2. Feed the wire through the machine and attach it to the circuit board.
3. The micro processor is fitted on the circuit board and a small wire is connected to the base of the circuit board.
4. The LCD now fits inside the larger top cover in the same spot.
Protocols
Materials
The following materials are provided in the PCR and Fluorimeter kit:
| Supplied in Kit | Amount
|
| Open PCR Machine | 1
|
| Fluorimeter | 1
|
| Phone Stand | 1
|
| Box | 1
|
| Superhydrophobic Slides | 10
|
| CD Software | 1
|
The following materials will need to be supplied by the user:
| Supplied by User | Amount
|
| Eppendorf tubes | 10
|
| Pipettes | 12
|
| Pipette Tips | 8
|
| Power source | 1
|
| Smartphone with Camera | 1
|
| ImageJ Software* | 1
|
| PCR Master Mix | 800 μL
|
| SYBR Green Solution | 10 mL
|
| DNA Samples | 6
|
| DNA Positive Control | 1
|
| DNA Negative Control | 1
|
| Calf Thymus DNA Sample | 1
|
| Water | 100 mL
|
| Plastic Tube-holding Grid | 1
|
- Note that the PCR machine does not require a computer but ImageJ does. A further improvement to this technology would be to design an app for ImageJ that can be used on smartphones.
PCR Protocol
In order to perform PCR, the samples must first be prepared. This is done by adhering to the following steps:
1. Open up all Eppendorf tubes that will be needed to perform the PCR. Place them in the plastic grid to hold them.
2. Fill each Eppendorf tube with 50 μL of the PCR Master Mix using a pipette.
3. Using a distinct, clean pipette tip per sample (including positive and negative controls), fill each tube with one DNA sample. Be sure to close each tube as you fill it with the DNA sample and label the lid. Throw away each pipette tip and place a new one on each time you are going to use a different sample to avoid contamination.
Now that the samples have been prepared, the PCR machine must then be configured to the specific cycling and temperature needs of your experiment. In this case, the instructions for carrying out PCR in one manner are as follows:
1. Turn on the Open PCR machine and press the forward arrow key to select PCR.
2. Set the lid temperature to 100°C and press the forward arrow key when done.
3. Set the initial temperature to 95°C. Press the forward arrow key and select 3 for the number of minutes to hold the tubes there.
4. Set the number of cycles to 30 and press the forward arrow key.
5. For the first temperature, set it to 95°C, press the forward arrow key, and set it for 30 seconds.
6. Select the second temperature of the cycle to be 57°C, press the forward arrow key and set it to 30 seconds.
7. Select the third temperature of the cycle to be 72°C, press the forward arrow key and set it to 30 seconds.
8. Set the final temperature to 72°C, press the forward arrow key, and select 3 minutes.
9. Set the hold for the tubes to be 4°C.
10. When ready, place the test tubes into the machine, close the lid and twist the top to hold it down, and select the forward arrow key to start the PCR. Note that if a mistake was made you may use the backward arrow key to scroll through the different settings you selected and alter as necessary.
DNA Measurement Protocol
The next part of the process is to measure the amount of replicated DNA and use a fluorimeter to determine whether or not someone has the mutation associated with cancer. The first part of this is to set up the fluorimeter correctly:
1. Pull out all of the materials in the box and open up one side of the box, placing it upside down on the table with the open side facing you.
2. Place a slide on the fluorimeter, glass side down, making sure that at least one row of holes lines up with the light.
3. Place the smartphone in the holder, making sure the camera is ready. This includes increasing the exposure, turning off the flash, and setting it to 800 mp.
4. Download the ImageJ software onto a computer or device that is compatible with the smartphone.
Now collection of the data may begin. This is done first by making sure that the experiment worked using the calf thymus DNA as a standard and then measuring the amount of green light from the added dye there is in order to determine the concentration of DNA:
1. Place a water droplet on the slide in the middle hole.
2. Gently add the SYBR Green dye droplet to the water droplet. Place this in the box with the light on and take a picture. This will be the baseline to determine the concentration of pixels in ImageJ when there is no DNA present.
3. Email this photo to a computer with ImageJ and upload it into the program. Split this image into the three component colors: blue, green, and red. Using only the image that shows green, place a circle around the droplet to determine the amount of green in the drop. Make a similar circle on an area of the image that is pitch black. Subtract the background density from the image density to determine the actual density.
4. Repeat steps 2 and 3 but add a droplet of calf thymus to the water droplet as well. This will ensure that the fluorimeter is working properly. Record the actual density of the pixels. This will become important for calculating the concentration of DNA. In order to calculate this, take the actual density and divide it by the calf thymus density and multiply by 2 (since the calf thymus had 2 μL of DNA).
5. Repeat steps 2 through 4 for each sample, including positive and negative controls, and for the three samples from each patient. If the concentration of DNA is similar to that of the calf thymus, this indicates that the person likely has the mutation associated with colon, rectal and/or pancreatic cancer.
Use of OpenPCR and Fluorimeter for More Cancer Markers
The OpenPCR may also be used to screen for additional types of cancer marker genes in DNA. In order to do so, the same procedure as before with the PCR machine and the fluorimeter must be followed. If the SYBR green shows that there is a cancer marker in the DNA, the specific type may be determined using the PCR machine a second time. In this instance, a sample from the patient who is believed to have a cancer marker will be placed into the PCR machine, but not for the purpose of replicating the DNA. Instead, the PCR machine can be set to various temperatures that are associated with the denaturation of each specific cancer marker since the hydrogen bond arrangement will be different and thus each specific marker will have its own temperature that breaks it down. These known temperatures will be used and the fluorimeter can be used a second time with SYBR green dye solution to determine how much less green light the sample emits. The percentage that it does not emit any more (meaning the difference from the first sample) indicates how much of a presence that specific cancer marker has.
Research and Development
Background on Disease Markers
We chose to make two different improvements to the PCR thermalcycler device, one that relates predominantly to the machine itself and one that relates predominantly to the research and development section of the group. The second improvement that we are planning is the ability to test for multiple strands of mutations via one PCR test. There are many different mutations cause one type of cancer (IE – there are 5 different mutations that cause pancreatic cancer) and therefore if we could include primers that detect for all these different mutations, we determine if the patient has Pancreatic Cancer with one test, not five different ones.
Pancreatic Carcinoma (most commonly referred to as pancreatic cancer) is a cancer of or tumor in the pancreas, a vital organ in both the digestive system and the endocrine system.
Pancreatic Cancer
Mutation 1: rs121912579
On chromosome 18
AGA>TGA: Arginine>Isoleucine
Occurs @ 48,604,721, changes SMAD4 Gene (nonsense)
Primer:
TGACAGAGCATCAAAGAAAC
Reverse Primer:
GGGTCTGCAATCGGCATGGT
Temperature Cycle:
Anneal Temp: 44 °C
Primer 1 Tm: 49 °C
Reverse Primer Tm: 61 °C
Bayes:
(p(A→T×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(A→T×%positive of Pancreatic Cancer)+p(A→T×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer))
Mutation 2: rs121912578
On chromosome 18
GAT>CAT: Aspartic Acid>Histidine
Occurs @ 48,604,655, changed SMAD4 Gene – signal transduction protein (Missense)
Primer:
CATGACCTTCGTCGCTTATG
Reverse Primer:
CCCCAACGGTAAAAGACCTC
Temperature Cycle:
Anneal Temp: 49 °C
Primer 1 Tm: 54 °C
Reverse Primer 2 Tm: 54 °C
Bayes:
(p(G→C×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(G→C×%positive of Pancreatic Cancer)+p(G→C×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer))
Mutation 3: rs121912577
On chromosome 18
TAC >TAG: Tyrosine > Stop(Amber)
Occurs @ 48,593,485, changes SMAD4 Gene (Nonsense)
Primer:
TAGTACTTAGACAGAGAGAA
Reverse Primer:
TAAATAAATAAAATTAAAAA
Temperature Cycle
Anneal Temp: 25 °C
Primer 1 Tm: 46 °C
Reverse Primer 2 Tm: 30 °C
Bayes:
(p(C→G×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(C→G×%positive of Pancreatic Cancer)+p(C→G×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer))
Mutation 4: rs121912662
On chromosome 17
Mutation 5: rs121908291
On chromosome 4
Our improvement:
We chose to improve the PCR process by including three primers that each detect one of the three different mutations detailed above. In order to do this properly, we would first need to include a negative control sample with all of the primers but no DNA template. There is a chance that the primers could bind with each other and amplify this way (more primers = more chance of this occurring), meaning that the flourimeter would catch this small amount of amplified primers and glow green, even though there is no DNA. We would have to compare each of our next samples with this negative control to ensure that there is a significant difference.
The next step is to make sure that each strand of DNA specific to each mutation (noted as M1, M2, and M3) are of different lengths. We chose to keep M1 at 100bp, M2 at 200bp, and M3 at 300bp. We continue with PCR amplification the same way as we did last week and keep all primers at a length of 20bp. We then take an initial flourimeter measure the same as last protocol, where we place 2 drops of green dye on the flourimeter, then two drops of the sample DNA. The concentration of green here will be 100% of the signal.
We then add dye to the sample, put it back into the thermalcycler and increase the temperature to the denaturing temperature of the short (100bp) strands. We take out this sample, put this into the flourimeter, and measure the “loss of concentration” of the dye. The amount of loss equals the amount of that specific mutation in our whole sample. Then we put it back into the thermalcycler at the denaturing temp for the 200bp sample and calculate the loss of concentration here, etc. By doing this, we can determine the amount of each mutation present in the sample and thus determine not only if a patient has evidence of Pancreatic Cancer, but which mutation is causing it.
Theory behind the process: when each mutation (m1, m2, and m3) are amplified, the length of the strands of the amplified DNA will be different depending on which mutation was amplified. For example, if M1 is amplified, the DNA strands will be relatively short (100bp), if M2 is amplified, the DNA strands will be 200bp, and if M3 is amplified, the DNA strands will be 300bp. The shorter DNA strands are more unstable and will denature at lower temperatures. If we begin with a green concentration that is 100%, then test samples that have been denatured at each of the various temperatures, the loss of concentration of the green will be the amount of that mutation present in the whole sample.
Illustration
|