BME103:T130 Group 9 l2: Difference between revisions
Bryce Munter (talk | contribs) |
|||
Line 160: | Line 160: | ||
'''Background on Disease Markers''' | '''Background on Disease Markers''' | ||
The improvement that we are planning is the ability to test for multiple strands of mutations via PCR test. | The improvement that we are planning is the ability to test for multiple strands of mutations via one PCR test. There are many different mutations cause one type of cancer (IE – there are 5 different mutations that cause pancreatic cancer) and therefore if we could include primers that detect for all these different mutations, we determine if the patient has Pancreatic Cancer with one test, not five different ones. | ||
Line 234: | Line 234: | ||
Mutation 5: rs121908291 | Mutation 5: rs121908291 | ||
On chromosome 4> | On chromosome 4> | ||
<br><br> | |||
Our improvement: including three primers that each detect one of the three different mutations. In order to do this properly, we would first need to include a negative control with all of the primers but no DNA template. There is a chance that the primers could bind with each other and amplify this way (more primers = more chance of this occurring), meaning that the flourimeter would catch this small amount of amplified primers and glow green, even though there is no DNA. We would have to compare each of our next samples with this negative control to ensure that there is a significant difference. | |||
<br><br> | |||
The next step is to make sure that each strand of DNA specific to each mutation (noted as M1, M2, and M3) are of different lengths. We chose to keep M1 at 100bp, M2 at 200bp, and M3 at 300bp. We continue with PCR amplification the same way as we did last week and keep all primers at a length of 20bp. We then take an initial flourimeter measure the same as last protocol, where we place 2 drops of green dye on the flourimeter, then two drops of the sample DNA. The concentration of green here will be 100% of the signal. | |||
<br><br> | |||
We then add dye to the sample, put it back into the thermalcycler and increase the temperature to the denaturing temperature of the short (100bp) strands. We take out this sample, put this into the flourimeter, and measure the “loss of concentration” of the dye. The amount of loss = the amount of that specific mutation in our whole sample. Then put it back into the thermalcycler at the denaturing temp for the 200bp sample and calculate the loss of concentration here, etc. | |||
<br><br> | |||
'''Theory behind this:''' when each mutation (m1, m2, and m3) are amplified, the length of the strands of the amplified DNA will be different depending on which mutation was amplified. for example, if M1 is amplified, the DNA strands will be relatively short (100bp), if M2 is amplified, the DNA strands will be 200bp, and if M3 is amplified, the DNA strands will be 300bp. The shorter DNA strands are more unstable and will denature at lower temperatures. If we begin with a green concentration that is 100%, then test samples that have been denatured at each of the various temperatures, the loss of concentration of the green will be the amount of that mutation present in the whole sample. | |||
Revision as of 00:15, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Installing the new modifications is a simple task as not much has changed and only one thing has been added. 1. Attach keypad to the extended portion of the top cover with the included screws. 2. Feed the wire through the machine and attach it to the circuit board. 3. The micro processor is fitted on the circuit board and a small wire is connected to the base of the circuit board. 4. The LCD now fits inside the larger top cover in the same spot.
ProtocolsMaterials
The following materials will need to be supplied by the user:
PCR Protocol In order to perform PCR, the samples must first be prepared. This is done by adhering to the following steps: Now that the samples have been prepared, the PCR machine must then be configured to the specific cycling and temperature needs of your experiment. In this case, the instructions for carrying out PCR in one manner are as follows:
Now collection of the data may begin. This is done first by making sure that the experiment worked using the calf thymus DNA as a standard and then measuring the amount of green light from the added dye there is in order to determine the concentration of DNA: Research and DevelopmentBackground on Disease Markers The improvement that we are planning is the ability to test for multiple strands of mutations via one PCR test. There are many different mutations cause one type of cancer (IE – there are 5 different mutations that cause pancreatic cancer) and therefore if we could include primers that detect for all these different mutations, we determine if the patient has Pancreatic Cancer with one test, not five different ones.
Mutation 1: rs121912579 On chromosome 18 AGA>TGA: Arginine>Isoleucine Occurs @ 48,604,721, changes SMAD4 Gene (nonsense) Primer: TGACAGAGCATCAAAGAAAC Reverse Primer: GGGTCTGCAATCGGCATGGT Temperature Cycle: Anneal Temp: 44 °C Primer 1 Tm: 49 °C Reverse Primer Tm: 61 °C
On chromosome 18 GAT>CAT: Aspartic Acid>Histidine Occurs @ 48,604,655, changed SMAD4 Gene – signal transduction protein (Missense) Primer: CATGACCTTCGTCGCTTATG Reverse Primer: CCCCAACGGTAAAAGACCTC Temperature Cycle: Anneal Temp: 49 °C Primer 1 Tm: 54 °C Reverse Primer 2 Tm: 54 °C
On chromosome 18 TAC >TAG: Tyrosine > Stop(Amber) Occurs @ 48,593,485, changes SMAD4 Gene (Nonsense) Primer: TAGTACTTAGACAGAGAGAA Reverse Primer: TAAATAAATAAAATTAAAAA Temperature Cycle Anneal Temp: 25 °C Primer 1 Tm: 46 °C Reverse Primer 2 Tm: 30 °C Mutation 4: rs121912662 On chromosome 17 Mutation 5: rs121908291 On chromosome 4>
Illustration
|