BME103:T130 Group 9

From OpenWetWare

Revision as of 16:39, 15 November 2012 by Daniel A. Saman (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Luke LammersProtocol Planner
Name: Luke Lammers
Protocol Planner
Name: Bryce MunterR & D Scientist
Name: Bryce Munter
R & D Scientist
Name: Daniel SamanOpenPCR Machine Engineer
Name: Daniel Saman
OpenPCR Machine Engineer
Name: Adrian MunozProtocol Planner
Name: Adrian Munoz
Protocol Planner
Name: David ProbstR & D Scientist
Name: David Probst
R & D Scientist

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design
Image:PCRNAMES.png

The Open PCR is a low cost thermal cycler that allows people to effectively duplicate DNA in a compact system. The Open PCR is very useful because it is open source which means it can be modified to meet the needs of different tasks. Open PCR is easy to use because you can easily connect it to a computer and run the program from there, which keeps the PCR quite small.


Experimenting With the Connections

When we unplugged the LCD from the Circuit Board, the display was disconnected and would not appear.The PCR would still work. When we unplugged the white wire that connects the PCB Circuit Board to Temperature Sensor, the machine would not be able to sense temperature correctly and would not give us a reading.


We first tested the Open PCR on 10/25/2012. The initial test run was fairly smooth as the Open PCR is very easy to use and very easy to take apart and examine.




Protocols

Polymerase Chain Reaction
Polymerase Chain Reaction (PCR) works by heating up a DNA sample in order to allow DNA primers to bind and replicate the desired gene; this process is repeated over and over again over a several hour duration in order to amplify the amount of that gene in the sample. This creates a testable amount of the DNA in order to screen it for certain cancer-associated polymorphisms, for instance. PCR involves heating the solution containing DNA in order to denature and unwind the DNA, separating the two. The mixture is then cooled slightly, allowing the DNA primers to bind to the single strands and begin coding the desired gene. This creates a second DNA sample that can then undergo PCR in addition to the original DNA sample. This process is repeated several times over several hours in order to get a large enough amount of the desired gene to test.

How to preform PCR

The process of PCR involves three basic steps that are repeated many times:
1. Denaturation: This step involves heating setting the lid to 100°C and the test tubes to 95°C for 3 minutes. This allows the mixture to heat up and for the DNA to unwind by breaking apart the hydrogen bonds between base pairs. The next 30 cycles involve setting the test tube to 95°C for 30 seconds to denature the DNA for a new reaction at the beginning of each cycle.
2. Annealing: The temperature is lowered to 57°C for 30 seconds each cycle in order to allow the primers to bind to the DNA.
3. Elongation: The temperature is raised to 72°C for 30 seconds to allow the primers to copy the desired DNA segment.

Thus the steps should look as follows:
1. Set the test tubes to 95°C for 3 minutes.
2. Complete 30 cycles of heating and cooling, with each cycle consisting of heating the tubes to 95°C for 30 seconds, then 57°C for 30 seconds, and then 72°C for 30 seconds.
3. Set the test tubes to 72°C for 3 minutes.
4. Hold the tubes at 4°C.

PCR master mix

The PCR master mix consists of the following:

  • bacterially derived Taq DNA polymerase
  • dNTPs
  • MgCl2
  • Reaction buffers

Reagent Volume
Template DNA (20 ng) 0.2 µL
10 µM forward primer 1.0 µL
10 µM reverse primer 1.0 µL
GoTaq master mix 50.0 µL
dH2O 47.8 µL
Total Volume 100 µL

Eight samples were tested during this investigation. These included: a positive control with the cancer DNA template, a negative control without the cancer DNA template, and three samples each from the two subjects. The first subject was a 46 year old woman, correlating to test tubes labeled 2, and the other was a 62 year old man, correlating to test tubes labeled 4.

Fluorimeter Setup and Measurements

The basic components of the fluorimeter.
The basic components of the fluorimeter.

Water droplet on superhydrophobic surface to place DNA in.
Water droplet on superhydrophobic surface to place DNA in.
Set up of the fluorimeter in the box with the smartphone camera facing it.
Set up of the fluorimeter in the box with the smartphone camera facing it.
With the light on, close the open space of the box and take a picture.
With the light on, close the open space of the box and take a picture.



In order to set up the fluorimeter, the following steps must be taken:

1. Remove the all the contents from the box. Open one of the small sides like a flap and place the box upside down on surface without the lid on. This will make the picture dark so only the blue light of the fluorimeter appears.
2. Place the superhydrophic slide in the fluorimeter, making sure the glass side is down and to align a row of holes with the light source.
3. Using a water dropper, place two to four droplets of water gently over the middle hole of the aligned row.
4. Place two to four droplets of the PCR solution for analysis into this water droplet. Be sure to be gentle as to not break surface tension.
5. Turn the light source on and place the fluorimeter in the box near the end of it that is already set up.
6. Place a smartphone with a good camera into the camera holder closer to the entrance of the box-cave.
7. Place your finger where the button to take a photo is and close the flap to reduce the amount of light from the outside coming in. Take a picture of the blue light shining through the solution.
8. Take several photos per solution being tested in order to get more stable data per that one solution of DNA being tested.
8. Repeat steps 2 through 8 for each solution of DNA used.

The next step is to analyze the resulting pictures by measuring the amount of pixels created by the light and comparing it to the controls. In order to measure this, the pictures must be analyzed using ImageJ software:
1. Download the ImageJ software from [1]
2. Email the photos to yourself and download them onto the computer with ImageJ.
3. Open up ImageJ and go to file > import > image sequence. Determine the numbers of the images in your folder based upon their position alphabetically and place this in the starting number. Make sure to only have 1 in the number of images.
4. Repeat step 3 for every picture taken, using the differing numbers associated with each image to import them.

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

Polymerase Chain Reaction (PCR) is a process by which we replicate DNA in order to determine specific sequences of DNA. In our specific lab, we used PCR to look for a sequence of nucleotides that signify cancer. On the surface level, we start with 2 strands of DNA, Magnesium Chloride (MgCl2), a TAQ enzyme, and DNTP, which is a mixture of the four bases – A, C, T, and G. We then set the PCR test to change temperatures after set periods of time to allow specific processes to work on the molecular level. We also add a fluorescent die that will bind to only the double strand of DNA.

At the molecular level, the process begins by breaking the hydrogen bonds to separate the two DNA strands. This can only be done by heating the PCR tubes holding the DNA solution to 95°C. When the OpenPCR converts to 57°C, the reagent, called a “primer,” detects a specific sequence – in this case, a cancer-specific sequence. We construct this primer to bind to the forward string of DNA that is the partner sequence to the cancerous sequence. If the cancerous sequence is not present, then the primer only connects to the forward strand of DNA. If the cancerous sequence is present, then the primer connects to both. The temperature then changes to 72°C and the TAQ polymerase enzyme then replicates only the DNA strand(s) that the primer binds to. MgCl2 binds to the TAQ to help it function properly; the concentration of MgCl2 is directly related to the speed at which the TAQ restrings the DNA. This entire process occurs many many times in order to replicate the DNA over and over again (we usually set the openPCR experiment for 30 cycles).

If the DNA is positive for cancer, the graph at the end of the experiment will be exponential because when it splits the two strings of DNA, the primer will find cancer on both strings of nucleotides. Both strings are then replicated, ergo the growth will be exponential. If the DNA is negative for cancer, the reagent will only attach to one of the strands and the graph will be more linear. Because the fluorescent die that we added in the beginning will only bind to the double strand of DNA, the DNA will glow (showing that there is an excessive amount of double stranded DNA- and thus cancer is present). If the DNA does not glow, there is no cancer present in the DNA.

Specific to this Cancer Sequence

The rs17879961 is the specific sequence, or primer, for replicating the cancerous sequence of DNA. In the normal DNA sequence, a Thymine nucleotide mutates to a Cytosine nucleotide, so the nucleotide within our primer is adenine to match with the thymine, the complementary nucleotide. This sequence is related to prostate cancer, colorectal cancer, and lung cancer. We have included the normal sequence, the mutated sequence, and the specific primers we included to determine whether or not the patient is positive for cancer. Other studies have shown that the I157T variant is present in 5.3% of the Finland population and 4.8% of the Poland population.


Normal: GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC

Mutated: GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC

Forward Primer: CCTTCACCCAGGATTTTTGAG

Reverse Primer: ATGTATCTTCTAGTGTCACCG

Bayes Equation

Bayes Test determines the reliability that a patient who test positive for cancer actually has cancer. In this equation, A equals the number of patients that test positive, and B is the number of patients that actually have cancer.

P(A|B)=(P(B|A)×P(A))÷P(B)


This demonstrates how PCR occurs in a three step cycle.



Results


After examining our images with the ImageJ software, we determined that patient #4, the 62 year old man, has evidence of cancer in his DNA, whereas patient #2, the 46 year old woman, does not. We measured drops of each sample in the flourimeter, as well as a positive control (the DNA Calf Thymus) and a negative control (water). The positive control - the dna that we know contains evidence of cancer - glowed green when placed under the blue LED light. When the negative control - the solution we know does not contain cancer or dna (water) - was observed with the flourimeter, the SYBR Green 1 solution did not activate under the blue LED light.

After using the imageJ software, we determined that the positive control (the calf thymus) had a SYBR Green 1 solution concentration of 2 and we used this number as a comparison to all our other concentration values. Patient #4, the 62 year old man, had concentrations in his three samples of DNA of 1.733, 1.551, and 1.666. Patient #2, the 46 year old woman, had concentrations in her three samples of DNA of 0.519, 0.335, and 0.241. The concentrations of the man's DNA are very close to the concentration of our positive control whereas the concentrations of the woman's DNA are close to the concentration of the negative control. Therefore, we conclude that the 62 year old man does in fact have cancer, and the 46 year old woman does not.

Image Analysis

Image: Results.png
DNA Concentration and Analysis

Description INTDEN with background subtracted DNA Concentration μg/mL
Water Blank 89580
DNA Calf Thymus 947312
Positive Control 918451.939
Negative Control 204450.432
46 Yr Female 1 245920.519
46 Yr Female 2 158870.335
46 Yr Female 3 114270.241
62 Yr Male 1 820181.733
62 Yr Male 2 734411.551
62 Yr Male 3 789321.666



Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control E6 F6 G6
PCR: Positive Control E7 F7 G7
PCR: Patient 1 ID #####, rep 1 E8 F8 G8
PCR: Patient 1 ID #####, rep 2 E9 F9 G9
PCR: Patient 1 ID #####, rep 3 E10 F10 G10
PCR: Patient 2 ID #####, rep 1 E11 F11 G11
PCR: Patient 2 ID #####, rep 2 E12 F12 G12
PCR: Patient 2 ID #####, rep 3 E13 F13 G13


KEY

  • Sample =
  • Integrated Density =
  • DNA μg/mL =
  • Conclusion =



Personal tools