BME103:T130 Group 9: Difference between revisions
Bryce Munter (talk | contribs) |
|||
Line 26: | Line 26: | ||
'''The Original Design'''<br> | '''The Original Design'''<br> | ||
[[Image: | [[Image:PCRNAMES.png]]<br> | ||
The Open PCR is a low cost thermal cycler that allows people to effectively duplicate DNA in a compact system. The Open PCR is very useful because it is open source which means it can be modified to meet the needs of different tasks. Open PCR is easy to use because you can easily connect it to a computer and run the program from there, which keeps the PCR quite small. | The Open PCR is a low cost thermal cycler that allows people to effectively duplicate DNA in a compact system. The Open PCR is very useful because it is open source which means it can be modified to meet the needs of different tasks. Open PCR is easy to use because you can easily connect it to a computer and run the program from there, which keeps the PCR quite small. |
Latest revision as of 13:39, 15 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Open PCR is a low cost thermal cycler that allows people to effectively duplicate DNA in a compact system. The Open PCR is very useful because it is open source which means it can be modified to meet the needs of different tasks. Open PCR is easy to use because you can easily connect it to a computer and run the program from there, which keeps the PCR quite small.
When we unplugged the LCD from the Circuit Board, the display was disconnected and would not appear.The PCR would still work. When we unplugged the white wire that connects the PCB Circuit Board to Temperature Sensor, the machine would not be able to sense temperature correctly and would not give us a reading.
ProtocolsPolymerase Chain Reaction
Eight samples were tested during this investigation. These included: a positive control with the cancer DNA template, a negative control without the cancer DNA template, and three samples each from the two subjects. The first subject was a 46 year old woman, correlating to test tubes labeled 2, and the other was a 62 year old man, correlating to test tubes labeled 4. Fluorimeter Setup and Measurements
The next step is to analyze the resulting pictures by measuring the amount of pixels created by the light and comparing it to the controls. In order to measure this, the pictures must be analyzed using ImageJ software: Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction (PCR) is a process by which we replicate DNA in order to determine specific sequences of DNA. In our specific lab, we used PCR to look for a sequence of nucleotides that signify cancer. On the surface level, we start with 2 strands of DNA, Magnesium Chloride (MgCl2), a TAQ enzyme, and DNTP, which is a mixture of the four bases – A, C, T, and G. We then set the PCR test to change temperatures after set periods of time to allow specific processes to work on the molecular level. We also add a fluorescent die that will bind to only the double strand of DNA. At the molecular level, the process begins by breaking the hydrogen bonds to separate the two DNA strands. This can only be done by heating the PCR tubes holding the DNA solution to 95°C. When the OpenPCR converts to 57°C, the reagent, called a “primer,” detects a specific sequence – in this case, a cancer-specific sequence. We construct this primer to bind to the forward string of DNA that is the partner sequence to the cancerous sequence. If the cancerous sequence is not present, then the primer only connects to the forward strand of DNA. If the cancerous sequence is present, then the primer connects to both. The temperature then changes to 72°C and the TAQ polymerase enzyme then replicates only the DNA strand(s) that the primer binds to. MgCl2 binds to the TAQ to help it function properly; the concentration of MgCl2 is directly related to the speed at which the TAQ restrings the DNA. This entire process occurs many many times in order to replicate the DNA over and over again (we usually set the openPCR experiment for 30 cycles). If the DNA is positive for cancer, the graph at the end of the experiment will be exponential because when it splits the two strings of DNA, the primer will find cancer on both strings of nucleotides. Both strings are then replicated, ergo the growth will be exponential. If the DNA is negative for cancer, the reagent will only attach to one of the strands and the graph will be more linear. Because the fluorescent die that we added in the beginning will only bind to the double strand of DNA, the DNA will glow (showing that there is an excessive amount of double stranded DNA- and thus cancer is present). If the DNA does not glow, there is no cancer present in the DNA. Specific to this Cancer Sequence The rs17879961 is the specific sequence, or primer, for replicating the cancerous sequence of DNA. In the normal DNA sequence, a Thymine nucleotide mutates to a Cytosine nucleotide, so the nucleotide within our primer is adenine to match with the thymine, the complementary nucleotide. This sequence is related to prostate cancer, colorectal cancer, and lung cancer. We have included the normal sequence, the mutated sequence, and the specific primers we included to determine whether or not the patient is positive for cancer. Other studies have shown that the I157T variant is present in 5.3% of the Finland population and 4.8% of the Poland population.
Normal: GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC Mutated: GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC Forward Primer: CCTTCACCCAGGATTTTTGAG Reverse Primer: ATGTATCTTCTAGTGTCACCG Bayes Equation
Results
After using the imageJ software, we determined that the positive control (the calf thymus) had a SYBR Green 1 solution concentration of 2 and we used this number as a comparison to all our other concentration values. Patient #4, the 62 year old man, had concentrations in his three samples of DNA of 1.733, 1.551, and 1.666. Patient #2, the 46 year old woman, had concentrations in her three samples of DNA of 0.519, 0.335, and 0.241. The concentrations of the man's DNA are very close to the concentration of our positive control whereas the concentrations of the woman's DNA are close to the concentration of the negative control. Therefore, we conclude that the 62 year old man does in fact have cancer, and the 46 year old woman does not. Image Analysis
|