BME103:T130 Group 6 l2: Difference between revisions
(12 intermediate revisions by 4 users not shown) | |||
Line 16: | Line 16: | ||
| [[Image:BME103_Group6_Ryan.png|100px|thumb|Name: Ryan Uchimura<br>Role: Experimental Protocol Planner/Coolest person ever]] | | [[Image:BME103_Group6_Ryan.png|100px|thumb|Name: Ryan Uchimura<br>Role: Experimental Protocol Planner/Coolest person ever]] | ||
| [[Image:Sam z pic.png|100px|thumb|Name: Sam Zimmerman<br>Role: OpenPCR Machine Engineer)]] | | [[Image:Sam z pic.png|100px|thumb|Name: Sam Zimmerman<br>Role: OpenPCR Machine Engineer)]] | ||
| [[Image: | | [[Image:AdamHelland.jpg|100px|thumb|Name: Adam Helland<br>Role:]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Dakota Styck<br>Role:]] | | [[Image:BME103student.jpg|100px|thumb|Name: Dakota Styck<br>Role:]] | ||
|} | |} | ||
Line 34: | Line 34: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:OpenPCR Before After.png|800x400px]]<br> | |||
To the left is the original design of the OpenPCR machine and it only has 16 slots for test tubes which amounts to four patients. On the right is our redesign which has 64 slots which amounts to 16 patients. | |||
'''Key Features'''<br> | '''Key Features'''<br> | ||
The key feature we modified was the main heating block. We increased the number of samples it can hold from 16 to 64. Because of the increased size of the heating block, the overall size of the PCR Machine is increased. As you can see in the picture, the redesigned PCR machine is quite a bit larger than the original but its footprint is still small enough to be easy to move and easily fit on a countertop. The heating lid is also equipped with raised tabs such that when the heating lid is lowered on to the samples it stops before crushing the tubes. | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
As our redesign only modified the size of the OpenPCR machine, the assembly instructions are identical to the original assembly instructions which can be found on the [http://openpcr.org/build-it/ OpenPCR Website] | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Line 78: | Line 79: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>Pipets - | <td>Pipets - 16</td> | ||
<td>Smartphone holder - 1</td> | <td>Smartphone holder - 1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>PCR reaction mix - | <td>PCR reaction mix - 16 tubes, 50 μL each</td> | ||
<td></td> | <td></td> | ||
Line 102: | Line 103: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>DNA - | <td>DNA - 16 samples</td> | ||
<td>Image J Software - 1</td> | <td>Image J Software - 1</td> | ||
</tr> | </tr> | ||
Line 114: | Line 115: | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
<br>1. Connect PCR to computer and install software.<br> | |||
2. Create a new program <br> | |||
set initial step to 95°C for 30 seconds, set for 30 cycles<br> | |||
denaturing- set temperature to 95°C for 30 seconds<br> | |||
annealing- set temperature to 57°C for 30 seconds<br> | |||
extension- set temperature to 72°C for 180 seconds, set to hold at 4°C<br> | |||
3. collect DNA samples | |||
4. mix each DNA sample with individual PCR solution (one pipet per sample) | |||
5. place DNA mixed with the PCR solution in the PCR machine | |||
6. once PCR is complete extract samples | |||
Line 140: | Line 150: | ||
<font face="century gothic"> | <font face="century gothic"> | ||
==Research and Development== | ==Research and Development== | ||
Line 172: | Line 183: | ||
<br><br> | <br><br> | ||
'''Primer Design''' | '''Primer Design'''<br> | ||
In order for the PCR to replicate only the DNA which contains the viral mutation we had to design specific primers for each SNP.<br> | In order for the PCR to replicate only the DNA which contains the viral mutation we had to design specific primers for each SNP.<br> | ||
<br><ul><li><b>SNP - rs799917</b><br> | <br><ul><li><b>SNP - rs799917</b><br> | ||
<b><u>Forward Primer:</u> <br> | <b><u>Forward Primer:</u> <br> | ||
5'</b>GCTTATCTTTCTGACCAACC<b>3'</b><br> | 5'</b> GCTTATCTTTCTGACCAACC <b>3'</b><br> | ||
<i>located at approximately 41,244, | <i>located at approximately 41,244,736bp - 41,244,756bp; 200bp to the left of the mutation</i><br> | ||
<b><u>Reverse Primer:</u><br> | <b><u>Reverse Primer:</u><br> | ||
3'</b>TCATTGCTC<font color="red">A/T</font color>GTTTTCAAA<b>5'</b><br><br></li> | 3'</b> TCATTGCTC<font color="red">A/T</font color>GTTTTCAAA <b>5'</b><br><br></li> | ||
<li><b>SNP - rs4986852</b><br> | <li><b>SNP - rs4986852</b><br> | ||
<b><u>Forward Primer:</u><br> | |||
5'</b> CAGGGATGCTTACAATTACTT <b>3'</b><br> | |||
<i>located at approximately 41,244,229bp -41,244,249bp; 200bp to the left of the mutation</i><br> | |||
<b><u>Reverse Primer:</u><br> | |||
3'</b> AAAGAAGCCA<font color="red">A</font color>CTCAAGCAA <b>5'</b></li></ul> | |||
< | <i>The primers are designed specifically to bind with DNA that contains the mutated allele. Once the primers bind to the DNA, then the Taq-polymerase knows where to replicate and the sequence containing the disease DNA will be replicated and amplified. Consequently, if the DNA does not contain the pathogenic allele then the primers won't be able to bind and nothing will be replicated. </i> | ||
<br><br> | <br><br> | ||
'''Illustration''' | '''Illustration'''<br> | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:Pcrdiagram.gif|464×598px]]<br> | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> |
Latest revision as of 18:52, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UP
PCR Machine Improvements
Thermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
ProtocolsMaterials
DNA Measurement Protocol
Research and DevelopmentBreast Cancer Markers
Background on Disease Markers
The primers are designed specifically to bind with DNA that contains the mutated allele. Once the primers bind to the DNA, then the Taq-polymerase knows where to replicate and the sequence containing the disease DNA will be replicated and amplified. Consequently, if the DNA does not contain the pathogenic allele then the primers won't be able to bind and nothing will be replicated.
|