|
|
| (13 intermediate revisions not shown.) |
| Line 16: |
Line 16: |
| | | [[Image:BME103_Group6_Ryan.png|100px|thumb|Name: Ryan Uchimura<br>Role: Experimental Protocol Planner/Coolest person ever]] | | | [[Image:BME103_Group6_Ryan.png|100px|thumb|Name: Ryan Uchimura<br>Role: Experimental Protocol Planner/Coolest person ever]] |
| | | [[Image:Sam z pic.png|100px|thumb|Name: Sam Zimmerman<br>Role: OpenPCR Machine Engineer)]] | | | [[Image:Sam z pic.png|100px|thumb|Name: Sam Zimmerman<br>Role: OpenPCR Machine Engineer)]] |
| - | | [[Image:BME103student.jpg|100px|thumb|Name: Adam Helland<br>Role:]] | + | | [[Image:AdamHelland.jpg|100px|thumb|Name: Adam Helland<br>Role:]] |
| | | [[Image:BME103student.jpg|100px|thumb|Name: Dakota Styck<br>Role:]] | | | [[Image:BME103student.jpg|100px|thumb|Name: Dakota Styck<br>Role:]] |
| | |} | | |} |
| Line 34: |
Line 34: |
| | '''System Design'''<br> | | '''System Design'''<br> |
| | | | |
| - | | + | [[Image:OpenPCR Before After.png|800x400px]]<br> |
| | + | To the left is the original design of the OpenPCR machine and it only has 16 slots for test tubes which amounts to four patients. On the right is our redesign which has 64 slots which amounts to 16 patients. |
| | | | |
| | '''Key Features'''<br> | | '''Key Features'''<br> |
| - | | + | The key feature we modified was the main heating block. We increased the number of samples it can hold from 16 to 64. Because of the increased size of the heating block, the overall size of the PCR Machine is increased. As you can see in the picture, the redesigned PCR machine is quite a bit larger than the original but its footprint is still small enough to be easy to move and easily fit on a countertop. The heating lid is also equipped with raised tabs such that when the heating lid is lowered on to the samples it stops before crushing the tubes. |
| | | | |
| | | | |
| | '''Instructions'''<br> | | '''Instructions'''<br> |
| - | | + | As our redesign only modified the size of the OpenPCR machine, the assembly instructions are identical to the original assembly instructions which can be found on the [http://openpcr.org/build-it/ OpenPCR Website] |
| | | | |
| | <!--- From Week 4 exercise ---> | | <!--- From Week 4 exercise ---> |
| Line 78: |
Line 79: |
| | </tr> | | </tr> |
| | <tr> | | <tr> |
| - | <td>Pipets - 8</td> | + | <td>Pipets - 16</td> |
| | <td>Smartphone holder - 1</td> | | <td>Smartphone holder - 1</td> |
| | </tr> | | </tr> |
| | <tr> | | <tr> |
| - | <td>PCR reaction mix - 8 tubes, 50 μL each</td> | + | <td>PCR reaction mix - 16 tubes, 50 μL each</td> |
| | <td></td> | | <td></td> |
| | | | |
| Line 102: |
Line 103: |
| | </tr> | | </tr> |
| | <tr> | | <tr> |
| - | <td>DNA - 8 samples</td> | + | <td>DNA - 16 samples</td> |
| | <td>Image J Software - 1</td> | | <td>Image J Software - 1</td> |
| | </tr> | | </tr> |
| Line 114: |
Line 115: |
| | | | |
| | '''PCR Protocol''' | | '''PCR Protocol''' |
| - | | + | <br>1. Connect PCR to computer and install software.<br> |
| | + | 2. Create a new program <br> |
| | + | set initial step to 95°C for 30 seconds, set for 30 cycles<br> |
| | + | denaturing- set temperature to 95°C for 30 seconds<br> |
| | + | annealing- set temperature to 57°C for 30 seconds<br> |
| | + | extension- set temperature to 72°C for 180 seconds, set to hold at 4°C<br> |
| | + | 3. collect DNA samples |
| | + | 4. mix each DNA sample with individual PCR solution (one pipet per sample) |
| | + | 5. place DNA mixed with the PCR solution in the PCR machine |
| | + | 6. once PCR is complete extract samples |
| | | | |
| | | | |
| Line 140: |
Line 150: |
| | | | |
| | <font face="century gothic"> | | <font face="century gothic"> |
| | + | |
| | ==Research and Development== | | ==Research and Development== |
| | | | |
| Line 172: |
Line 183: |
| | | | |
| | <br><br> | | <br><br> |
| - | '''Primer Design''' | + | '''Primer Design'''<br> |
| | In order for the PCR to replicate only the DNA which contains the viral mutation we had to design specific primers for each SNP.<br> | | In order for the PCR to replicate only the DNA which contains the viral mutation we had to design specific primers for each SNP.<br> |
| | <br><ul><li><b>SNP - rs799917</b><br> | | <br><ul><li><b>SNP - rs799917</b><br> |
| - | <b><u>Forward Primer:</u>5'</b>GCTTATCTTTCTGACCAACC<b>3'</b><br> | + | <b><u>Forward Primer:</u> <br> |
| - | <i>located at approximately 41,244,736 - 41,244,756; 200bp to the left of the mutation</i><br> | + | 5'</b> GCTTATCTTTCTGACCAACC <b>3'</b><br> |
| - | <b><u>Reverse Primer:</u>3'</b>TCATTGCTC<font color="red">A/T</font color>GTTTTCAAA<b>5'</b><br><br></li> | + | <i>located at approximately 41,244,736bp - 41,244,756bp; 200bp to the left of the mutation</i><br> |
| | + | <b><u>Reverse Primer:</u><br> |
| | + | 3'</b> TCATTGCTC<font color="red">A/T</font color>GTTTTCAAA <b>5'</b><br><br></li> |
| | <li><b>SNP - rs4986852</b><br> | | <li><b>SNP - rs4986852</b><br> |
| | + | <b><u>Forward Primer:</u><br> |
| | + | 5'</b> CAGGGATGCTTACAATTACTT <b>3'</b><br> |
| | + | <i>located at approximately 41,244,229bp -41,244,249bp; 200bp to the left of the mutation</i><br> |
| | + | <b><u>Reverse Primer:</u><br> |
| | + | 3'</b> AAAGAAGCCA<font color="red">A</font color>CTCAAGCAA <b>5'</b></li></ul> |
| | | | |
| - | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | + | <i>The primers are designed specifically to bind with DNA that contains the mutated allele. Once the primers bind to the DNA, then the Taq-polymerase knows where to replicate and the sequence containing the disease DNA will be replicated and amplified. Consequently, if the DNA does not contain the pathogenic allele then the primers won't be able to bind and nothing will be replicated. </i> |
| | | | |
| | | | |
| | | | |
| | <br><br> | | <br><br> |
| - | '''Illustration''' | + | '''Illustration'''<br> |
| | | | |
| | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> |
| - | | + | [[Image:Pcrdiagram.gif|464×598px]]<br> |
| | | | |
| | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> |
BME 103 Fall 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
|
|
OUR TEAM
Name: Jocelynn Christensen Role: R & D Scientist
| Name: Ryan Uchimura Role: Experimental Protocol Planner/Coolest person ever
| Name: Sam Zimmerman Role: OpenPCR Machine Engineer)
|
|
|
LAB 2 WRITE-UP
PCR Machine Improvements
Design Goals:
Expand Sample Size; which will increase efficiency
Add Tabs to the Bottom of the Lid; this will make it so that the user knows when the lid is on completely without crushing the samples.
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design

To the left is the original design of the OpenPCR machine and it only has 16 slots for test tubes which amounts to four patients. On the right is our redesign which has 64 slots which amounts to 16 patients.
Key Features
The key feature we modified was the main heating block. We increased the number of samples it can hold from 16 to 64. Because of the increased size of the heating block, the overall size of the PCR Machine is increased. As you can see in the picture, the redesigned PCR machine is quite a bit larger than the original but its footprint is still small enough to be easy to move and easily fit on a countertop. The heating lid is also equipped with raised tabs such that when the heating lid is lowered on to the samples it stops before crushing the tubes.
Instructions
As our redesign only modified the size of the OpenPCR machine, the assembly instructions are identical to the original assembly instructions which can be found on the OpenPCR Website
Protocols
Materials
Supplied in the Kit
| PCR |
Flourimeter |
| gloves/labcoat - 1 |
flourimeter - 1 |
| PCR machine - 1 |
Box - 1 |
| Pipets - 16 |
Smartphone holder - 1 |
| PCR reaction mix - 16 tubes, 50 μL each |
|
| PCR holding tray - 1 |
|
Supplied by User
| PCR |
Flourimeter |
| Computer - 1 |
Smartphone/Camera - 1 |
| DNA - 16 samples |
Image J Software - 1 |
PCR Protocol
1. Connect PCR to computer and install software.
2. Create a new program
set initial step to 95°C for 30 seconds, set for 30 cycles
denaturing- set temperature to 95°C for 30 seconds
annealing- set temperature to 57°C for 30 seconds
extension- set temperature to 72°C for 180 seconds, set to hold at 4°C
3. collect DNA samples
4. mix each DNA sample with individual PCR solution (one pipet per sample)
5. place DNA mixed with the PCR solution in the PCR machine
6. once PCR is complete extract samples
DNA Measurement Protocol
1. Take the file box and place it upside down (after it's been emptied) so that there is now an area that will restrict as much light as possible from coming through in the pictures.
2. Place the hydrophobic slide in the center of the fluorimeter and align it so that the row of dots is directly in the middle of the blue lazer.
3. Using a pipet, place two droplets of water gently on the middle hole of the slide.
4. Next use the pipet to add two droplets of the PCR solution for the first sample with the two water droplets. This must be done cautiously so that the droplets will stay in the center and adhere to each other properly.
5. Turn on the light source on and place the fluorimeter as far back as possible inside the upside down box.
6. Turn the camera on a smart phone and adjust the settings accordingly. Inactivate the flash, set iso to 800 (or higher if possible), set white balance to auto, exposure to the highest setting, saturation to highest setting and contrast to the lowest setting.
7. Place a smartphone camera into the cradle and then move the cradle in front of the fluorimeter at the perfect distance for good resolution (may take some adjusting).
8. Take a picture of the mixture on the fluorimeter (best done if camera is on a timer so that you can fully close the box and avoid excess light exposure.
9. Repeat steps 2-8 for each sample.
1. Download the Image J software
2. Open Image J
3. To chose your pictures click 'file' and 'open' then select the image you wish to analyze
3. Once your image is opened highlight and click on "analyze", "set measurements", and check the boxes "area" "integrated density" and "mean gray value" in order to just analyze the pieces for this lab.
4. After this you have to highlight and click "image", "color", then click "split channels"
5. This splits the image you have into three new images. For this assignment just keep the image "green" and disregard the others.
6. Then analyze the droplet in the picture to get the info for integrated density, mean gray value, and area.
7. Repeat steps for one picture of each sample.
8. Save your data in an excel page for easy access at another time
Research and Development
Breast Cancer Markers
Without including skin cancer, breast cancer is the most frequently diagnosed cancer in women today. While there's not one specific "cause" of breast cancer many things like excessive weight gain after age 18, use of estrogen and progestin hormone therapy, physical inactivity, as well as alcohol consumption have all been identified as risk-factors for breast cancer. While those may be avoidable risks there are some risks that cannot be avoided because they're genetically encoded in our DNA. Breast cancer has been linked to certain genetic mutations in the BRCA1 gene as well as the BRCA2 gene. While having a mutation of either of these genes doesn't guarantee breast cancer, someone with a mutation on either gene is 5 times more likely to develop breast cancer during their life.
The BRCA1&2 genes have been identified as tumor suppressor genes on the 17th chromosome. Specifically looking at BRCA1, the gene encodes a nuclear phosphoprotein who's job is to maintain genomic stability and act as a tumor suppressor. This protein plays a huge role in transcription, DNA repair, and recombination. When this gene is mutated it's responsible for nearly 40% of inherited breast cancers.
Background on Disease Markers
There are thousands of mutations associated with the BRCA1 gene.
Here are two examples:
- Single Nucleotide Polymorphism (SNP) - rs799917
NCBI database rs799917
Location: Chromosome 17 at position 41,244,936bp.
Variation Type: Single Nucleotide Variation; Missense Mutation
Reference strand (41,244,962 bp-41,244,911 bp):
3' GGTTTCAAAGCGCCAGTCATTTGCTC[A/C/T*]GTTTTCAAATCCAGGAAATGCAGAA 5' * This represents C as the normal base and A/T as the possible mutations for this SNP.
If Cytosine is replaced by Adenine or Thymine in this sequence the resulting amino acid would either be glutamine or leucine respectively instead of proline. This change in amino acids will result in an alteration to the overall protein. Something this small is what could cause a cancerous gene.
-
Single Nucleotide Polymorphism - rs4986852
NCBI database rs4986852
Location: Chromosome 17 at position 41,244,429bp.
Variation Type: Single Nucleotide Variation; Missense Mutation
Reference strand (41,244,455 bp-41,244,404 bp):
3' TAGAGAAAATGTTTTTAAAGAAGCCA[A/G*]CTCAAGCAATATTAATGAAGTAGGT 5'
- This represents G as the normal base and C as the possible mutation for this SNP.
If Guanine is replaced with Cytosine then Asparagine will be produced instead of Serine which will also cause a change in the protein that has been connected to BRCA1.
Primer Design
In order for the PCR to replicate only the DNA which contains the viral mutation we had to design specific primers for each SNP.
- SNP - rs799917
Forward Primer:
5' GCTTATCTTTCTGACCAACC 3'
located at approximately 41,244,736bp - 41,244,756bp; 200bp to the left of the mutation
Reverse Primer:
3' TCATTGCTCA/TGTTTTCAAA 5'
- SNP - rs4986852
Forward Primer:
5' CAGGGATGCTTACAATTACTT 3'
located at approximately 41,244,229bp -41,244,249bp; 200bp to the left of the mutation
Reverse Primer:
3' AAAGAAGCCAACTCAAGCAA 5'
The primers are designed specifically to bind with DNA that contains the mutated allele. Once the primers bind to the DNA, then the Taq-polymerase knows where to replicate and the sequence containing the disease DNA will be replicated and amplified. Consequently, if the DNA does not contain the pathogenic allele then the primers won't be able to bind and nothing will be replicated.
Illustration

|