OUR TEAM
Name: Jocelynn Christensen Role: R & D Scientist
| Name: Ryan Uchimura Role: Experimental Protocol Planner/Coolest person ever
| Name: Sam Zimmerman Role: OpenPCR Machine Engineer)
|
|
|
LAB 2 WRITE-UP
PCR Machine Improvements
Design Goals:
Expand Sample Size; which will increase efficiency
Add Tabs to the Bottom of the Lid; this will make it so that the user knows when the lid is on completely without crushing the samples.
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design

Key Features
The key feature we modified was the main heating block. We increased the number of samples it can hold from 16 to 64. Because of the increased size of the heating block that also has an effect on the overall size of the PCR Machine. As you can see in the picture, the redesigned PCR machine is quite a bit larger than the original but still small enough to be easy to move and fit on a countertop.
Instructions
Protocols
Materials
Supplied in the Kit
| PCR |
Flourimeter |
| gloves/labcoat - 1 |
flourimeter - 1 |
| PCR machine - 1 |
Box - 1 |
| Pipets - 8 |
Smartphone holder - 1 |
| PCR reaction mix - 8 tubes, 50 μL each |
|
| PCR holding tray - 1 |
|
Supplied by User
| PCR |
Flourimeter |
| Computer - 1 |
Smartphone/Camera - 1 |
| DNA - 8 samples |
Image J Software - 1 |
PCR Protocol
DNA Measurement Protocol
1. Take the file box and place it upside down (after it's been emptied) so that there is now an area that will restrict as much light as possible from coming through in the pictures.
2. Place the hydrophobic slide in the center of the fluorimeter and align it so that the row of dots is directly in the middle of the blue lazer.
3. Using a pipet, place two droplets of water gently on the middle hole of the slide.
4. Next use the pipet to add two droplets of the PCR solution for the first sample with the two water droplets. This must be done cautiously so that the droplets will stay in the center and adhere to each other properly.
5. Turn on the light source on and place the fluorimeter as far back as possible inside the upside down box.
6. Turn the camera on a smart phone and adjust the settings accordingly. Inactivate the flash, set iso to 800 (or higher if possible), set white balance to auto, exposure to the highest setting, saturation to highest setting and contrast to the lowest setting.
7. Place a smartphone camera into the cradle and then move the cradle in front of the fluorimeter at the perfect distance for good resolution (may take some adjusting).
8. Take a picture of the mixture on the fluorimeter (best done if camera is on a timer so that you can fully close the box and avoid excess light exposure.
9. Repeat steps 2-8 for each sample.
1. Download the Image J software
2. Open Image J
3. To chose your pictures click 'file' and 'open' then select the image you wish to analyze
3. Once your image is opened highlight and click on "analyze", "set measurements", and check the boxes "area" "integrated density" and "mean gray value" in order to just analyze the pieces for this lab.
4. After this you have to highlight and click "image", "color", then click "split channels"
5. This splits the image you have into three new images. For this assignment just keep the image "green" and disregard the others.
6. Then analyze the droplet in the picture to get the info for integrated density, mean gray value, and area.
7. Repeat steps for one picture of each sample.
8. Save your data in an excel page for easy access at another time
Research and Development
Breast Cancer Markers
Without including skin cancer, breast cancer is the most frequently diagnosed cancer in women today. While there's not one specific "cause" of breast cancer many things like excessive weight gain after age 18, use of estrogen and progestin hormone therapy, physical inactivity, as well as alcohol consumption have all been identified as risk-factors for breast cancer. While those may be avoidable risks there are some risks that cannot be avoided because they're genetically encoded in our DNA. Breast cancer has been linked to certain genetic mutations in the BRCA1 gene as well as the BRCA2 gene. While having a mutation of either of these genes doesn't guarantee breast cancer, someone with a mutation on either gene is 5 times more likely to develop breast cancer during their life.
The BRCA1&2 genes have been identified as tumor suppressor genes on the 17th chromosome. Specifically looking at BRCA1, the gene encodes a nuclear phosphoprotein who's job is to maintain genomic stability and act as a tumor suppressor. This protein plays a huge role in transcription, DNA repair, and recombination. When this gene is mutated it's responsible for nearly 40% of inherited breast cancers.
Background on Disease Markers
There are thousands of mutations associated with the BRCA1 gene.
Here are two examples:
- Single Nucleotide Polymorphism (SNP) - rs799917
NCBI database rs799917
Location: Chromosome 17 at position 41,244,936bp.
Variation Type: Single Nucleotide Variation; Missense Mutation
Reference strand (41,244,962 bp-41,244,911 bp):
3' GGTTTCAAAGCGCCAGTCATTTGCTC[A/C/T*]GTTTTCAAATCCAGGAAATGCAGAA 5' * This represents C as the normal base and A/T as the possible mutations for this SNP.
If Cytosine is replaced by Adenine or Thymine in this sequence the resulting amino acid would either be glutamine or leucine respectively instead of proline. This change in amino acids will result in an alteration to the overall protein. Something this small is what could cause a cancerous gene.
-
Single Nucleotide Polymorphism - rs4986852
NCBI database rs4986852
Location: Chromosome 17 at position 41,244,429bp.
Variation Type: Single Nucleotide Variation; Missense Mutation
Reference strand (41,244,455 bp-41,244,404 bp):
3' TAGAGAAAATGTTTTTAAAGAAGCCA[A/G*]CTCAAGCAATATTAATGAAGTAGGT 5'
- This represents G as the normal base and C as the possible mutation for this SNP.
If Guanine is replaced with Cytosine then Asparagine will be produced instead of Serine which will also cause a change in the protein that has been connected to BRCA1.
Primer Design
In order for the PCR to replicate only the DNA which contains the viral mutation we had to design specific primers for each SNP.
- SNP - rs799917
Forward Primer:
5' GCTTATCTTTCTGACCAACC 3'
located at approximately 41,244,736bp - 41,244,756bp; 200bp to the left of the mutation
Reverse Primer:
3' TCATTGCTCA/TGTTTTCAAA 5'
- SNP - rs4986852
Forward Primer:
5' CAGGGATGCTTACAATTACTT 3'
located at approximately 41,244,229bp -41,244,249bp; 200bp to the left of the mutation
Reverse Primer:
3' AAAGAAGCCAACTCAAGCAA 5'
The primers are designed specifically to bind with DNA that contains the mutated allele. Once the primers bind to the DNA, then the Taq-polymerase knows where to replicate and the sequence containing the disease DNA will be replicated and amplified. Consequently, if the DNA does not contain the pathogenic allele then the primers won't be able to bind and nothing will be replicated.
Illustration
|