BME103:T130 Group 6 l2: Difference between revisions
Line 139: | Line 139: | ||
8. Save your data in an excel page for easy access at another time<br> | 8. Save your data in an excel page for easy access at another time<br> | ||
<font face="century gothic"> | |||
==Research and Development== | ==Research and Development== | ||
<!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers ---> | <!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers ---> | ||
'''Breast Cancer Markers''' | |||
<br> <br>Without including skin cancer, breast cancer is the most frequently diagnosed cancer in women today. While there's not one specific "cause" of breast cancer many things like excessive weight gain after age 18, use of estrogen and progestin hormone therapy, physical inactivity, as well as alcohol consumption have all been identified as risk-factors for breast cancer. While those may be avoidable risks there are some risks that cannot be avoided because they're genetically encoded in our DNA. Breast cancer has been linked to certain genetic mutations in the BRCA1 gene as well as the BRCA2 gene. While having a mutation of either of these genes doesn't guarantee breast cancer, someone with a mutation on either gene is 5 times more likely to develop breast cancer during their life. <br> | |||
The BRCA1&2 genes have been identified as tumor suppressor genes on the 17th chromosome. Specifically looking at BRCA1, the gene encodes a nuclear phosphoprotein who's job is to maintain genomic stability and act as a tumor suppressor. This protein plays a huge role in transcription, DNA repair, and recombination. When this gene is mutated it's responsible for nearly 40% of inherited breast cancers. <br><br> | |||
'''Background on Disease Markers''' | '''Background on Disease Markers''' | ||
<br><br>There are thousands of mutations associated with the BRCA1 gene. <br> | |||
<ul>Here are two examples:<br> | |||
<li> <b>Single Nucleotide Polymorphism - <font color="red">rs799917</font color></b><br> | |||
<u>Location:</u> <i>Chromosome 17 at position 41,244,936bp. </i><br> | |||
<u>Variation Type:</u> <i>Single Nucleotide Variation</i><br> | |||
<u>Reference strand (<i>41,244,962 bp-41,244,911 bp</i>):</u> <b>3'</b>GGTTTCAAAGCGCCAGTCATTTGCTC<font color="Red">[A/C/T]</font color>GTTTTCAAATCCAGGAAATGCAGAA<b>5'</b><br><br> | |||
<b><u>Forward Primer:</u>5'</b>GCTTATCTTTCTGACCAACC<b>3'</b><br> | |||
<i>located at approximately 41,244,736 - 41,244,756; 200bp to the left of the mutation</i><br> | |||
<b><u>Reverse Primer:</u>3'</b>TCATTGCTC<font color="red">A/T</font color>GTTTTCAAA<b>5'</b><br> | |||
<br> | |||
<li> <b>Single Nucleotide Polymorphism - <font color="red">rs</font color></b><br> | |||
< | </ul> | ||
<br><br> | |||
'''Primer Design''' | '''Primer Design''' | ||
Line 157: | Line 172: | ||
<br><br> | |||
'''Illustration''' | '''Illustration''' | ||
Line 164: | Line 179: | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Revision as of 03:06, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UP
PCR Machine Improvements
Thermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
Research and DevelopmentBreast Cancer Markers
Background on Disease Markers
|