Brent Hayes Russon Research and Development Specialist
Abdulaziz Alamal Open PCR Machine Engineer
Andrew Munoz Experimental Protocol Planner
Name: Abdullah Alqahtani
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design
Image:PCR.png
( , from the Week 3 exercise. Write a paragraph description for visitors who have no idea what this is)
Experimenting With the Connections
When we unplugged (part 3) from (part 6).
Part 3 is called the Heat sink, and part 6 is called Brain Board. When we unplugged part 3 from part 6, we'll see obviously some changes. Basically we see that the screen is turning off, so those parts help to show the information for any experiment that we do.
When we unplugged the white wire that connects (part 6) to (part 2),
As I mentioned, we called part 6 the Brain Board, also part 2 is called Heated Lid or Temperature sensor. When we unplugged those parts, we got changes as well. We could determine that we could not get any information, because there is nothing could measure our sample or give us the right temperature. Also it'll stop reading the temperature.
Test Run
(Write the date you first tested Open PCR and your experience(s) with the machine)
Protocols
Polymerase Chain Reaction
PCR is used to generate copies of a specific sequence of DNA in massive quantities. This is done by exposing the DNA to heat in order to denature it into two strands, then cooling it so that primers can bind to either end of the target sequence. The primers restrict the area that can be replicated to only the desired sequence. Next, heat-resistant Taq DNA polymerase (usually taken from bacteria) copies in complementary strands for both template strands, doubling the amount of DNA. This process of denaturing and replicating is repeated over and over until the desired amount of DNA is generated.
Steps to PCR
Put the extracted DNA in a PCR tube.
Add the forward and reverse primers to the tube.
Add the master mix to the tube.
Place the tube in the PCR machine and start the program. Each cycle of the program involves 3 parts.
Denaturation: The DNA is first heated to 95°C to denature it.
Annealing: The DNA is cooled to 57°C to allow the primers to bind to each template strand.
Elongation: The DNA is heated back up to 72°C to prompt the Taq DNA polymerase to copy in complementary strands.
The DNA is cycled 30 times before being held at 4°C.
Put the slide into the fluorimeter with the glass side facing down.
Using the pipette marked with the blue stripe, place one droplet of SYBR GREEN I in the middle well of the first row and one droplet of SYBR GREEN I in the middle well of the second row. The two droplets should combine into one big drop.
Using a separate clean pipette, add two droplets of the sample being tested to the SYBR GREEN I drop.
Adjust the slide as needed so the drop is aligned with the fluorimeter's light. The light should shine through the middle of the drop when you turn it on.
Adjust your smartphone camera's settings as follows: turn off the flash, set the ISO to ≥800, set the white balance to auto, set exposure and saturation to their highest settings, and set contrast to the lowest setting.
Stand the smartphone upright in the cradle and set the cradle a few inches away from the fluorimeter.
Place the light box over the entire setup and turn on the fluorimeter's light.
If the smartphone has a timer setting, set it and shut the light box so photos of the drop can be taken in complete darkness. Otherwise, keep the flap lowered as much as possible while you manually take photos.
Clean off the first drop and repeat steps 2-3 using the next two rows of wells and the next sample to be tested. Up to 5 samples can be tested per slide. Obtain a new slide when all rows of wells have been used.
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
The r17879961 sequence has a possible nucleotide alteration that is cancer associated. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found on the bottom strand of DNA and so the bottom strand is considered the template DNA. (Note, this is the bottom strand that does have the cancer-associated nucleotide of a C). A DNA primer is developed that is 20 letters long. A DNA primer is essentially just a synthetic copy of the DNA sequence, ours going out 20 places. Another primer is made for the corresponding top half 200 letters down the DNA sequence. For this specific cancer-associated sequence, the bottom primer is [AACTCTTACACTGCATACAT] (The genetic variant "C" is bolded) and the top primer is [TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA, but only if there is a matching genetic code for it to attach to. So the top primer should always have a matching pair to attach to because there should be no genetic variance in it's counterpart while the bottom primer will only match up with a top part of DNA if the mutation is present. A Taq Polymerase then connects to both primers, which with Magnesium Chloride, makes it possible for free floating nucleotides to fill in the rest of the missing DNA strand. This process is then repeated numerous times. If the mutation is not present then only the top primer will find a match and so the reproduction of DNA will not show the a noticeable increase. If the mutation is present in the subject's DNA then both primers will find matching pairs and create two full new sets of this sequence. As the process is repeated the amount of the sequences present will increase exponentially.
(Add a write-up of the information discussed in Week 3's class)
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
BME 103 Fall 2012
