BME103:T130 Group 3 l2
From OpenWetWare
(→Protocols) |
Current revision (16:37, 29 November 2012) (view source) (→Protocols) |
||
| (33 intermediate revisions not shown.) | |||
| Line 26: | Line 26: | ||
==Thermal Cycler Engineering== | ==Thermal Cycler Engineering== | ||
| - | Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br> | + | Our re-design is based upon the [http://openpcr.org Open PCR] system that was originally designed by Josh Perfetto and Tito Jankowski.<br> |
'''System Design'''<br> | '''System Design'''<br> | ||
| - | + | [[Image:G1.jpg]][[Image:G2.jpg]]<br>[[Image:G3.jpg]][[Image:G4.jpg]] | |
'''Key Features'''<br> | '''Key Features'''<br> | ||
| - | + | The specific feature being focused on to improve the Open PCR Machine is the heating and cooling aspect of the PCR machine. The main alteration of the machine would be to change the material used on the heat sink and heating pad to copper. This would allow for a much quicker change in temperature while the machine is running. Therefore, the heating and cooling phases of the cycles would be attained faster, thus cutting the time of a full PCR efficiently. The material change from a zinc alloy to copper would make heating and cooling the cycles of the PCR machine much quicker because copper is the most electrically conductive metal. | |
'''Instructions'''<br> | '''Instructions'''<br> | ||
| - | + | There was only a change in the material that is used to make the heat sink and heating pad, so the assembly instruction will remain the same as the original design. | |
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 47: | Line 47: | ||
==Protocols== | ==Protocols== | ||
| - | <font size=3><b> | + | <font size=3><b>Materials</b></font><br><br> |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
{| {{table}} | {| {{table}} | ||
| - | | align="center" style="background:#f0f0f0;"|''' | + | | align="center" style="background:#f0f0f0;"|'''Supplied in the Kit''' |
| - | + | ||
|- | |- | ||
| - | | | + | | PCR Machine |
|- | |- | ||
| - | | 10μM forward primer | + | | 10μM forward primer |
|- | |- | ||
| - | | 10μM reverse primer | + | | 10μM reverse primer |
|- | |- | ||
| - | | GoTaq master mix|| | + | | GoTaq master mix |
| + | |} | ||
| + | |||
| + | {| {{table}} | ||
| + | | align="center" style="background:#f0f0f0;"|'''Supplied by the User''' | ||
|- | |- | ||
| - | | | + | | Template DNA |
|- | |- | ||
| - | | | + | | Distilled Water |
| + | |- | ||
| + | | Pipets | ||
| + | |- | ||
| + | | Eppendorf Tubes | ||
|} | |} | ||
| - | + | <font size=3><b>PCR Protocol</b></font><br><br> | |
| + | |||
| + | 1.) Pipet 0.1μL of template DNA, 0.5μL of 10μM forward primer, 0.5μL of 10μM reverse primer, 25.0μL of GoTaq Master Mix, and 23.9μL of dH20 in an Eppendorf tube. All of these items mixed together should create a total volume of 50.0μL.<br> | ||
| + | 2.) Up to 16 of these samples are then loaded into the PCR machine<br> | ||
| + | 3.) The DNA samples are then heated to ninety-five degrees Celsius (95°C) for one (1) minute in order to unzip the two single strands. <br> | ||
| + | 4.) They are then cooled to fifty-seven degrees Celsius (57°C) for ten (10) seconds so that the primers can attach to their matching sequences. <br> | ||
| + | 5.) Finally, they are heated back to seventy-two degrees Celsius (72°C) for ten (10) seconds, and polymerase extends the DNA strands by attaching the correct free nucleotides in order on the single strands. <br><br> | ||
<font size=3>'''DNA Measurement Protocol'''</font><br><br> | <font size=3>'''DNA Measurement Protocol'''</font><br><br> | ||
| + | |||
| + | [[Image:Flourimeter Group 3.jpg|600x300px]]<br><br> | ||
<b>'''Fluorimeter Setup'''</b><br> | <b>'''Fluorimeter Setup'''</b><br> | ||
| - | 1.) The lid was first taken off | + | 1.) The lid was first taken off the box and one of its sides was unbuttoned in order to create a flap.<br> |
| - | 2.) The box was | + | 2.) The box was then flipped upside down in order to create a dark environment for the camera.<br> |
| - | 3.) A hydrophobic slide was then inserted into the | + | 3.) A hydrophobic slide was then inserted into the fluorimeter.<br> |
4.) Finally, the camera phone was placed in the stand. | 4.) Finally, the camera phone was placed in the stand. | ||
<b>Fluorimeter Measurements</b><br> | <b>Fluorimeter Measurements</b><br> | ||
1.) Label transfer pipettes and tubes<br> | 1.) Label transfer pipettes and tubes<br> | ||
| - | 2.) Transfer each sample separately into tube containing 400μl of buffer<Br> | + | 2.) Transfer each sample separately into a tube containing 400μl of buffer<Br> |
| - | 3.) Take the specifically labeled tube containing SYBR GREEN 1 and place | + | 3.) Take the specifically labeled tube containing SYBR GREEN 1 and place two drops on the first two centered drops <br> |
| - | 4.) Place | + | 4.) Place two drops of diluted sample on top of the SYBR GREEN 1 drop<br> |
5.) Align light through drop<br> | 5.) Align light through drop<br> | ||
6.) Take pictures using light box<br> | 6.) Take pictures using light box<br> | ||
| Line 110: | Line 112: | ||
9.) Drag circle to the background of the image <br> | 9.) Drag circle to the background of the image <br> | ||
10.) Record results <br> | 10.) Record results <br> | ||
| - | 11.) Repeat if necessary | + | 11.) Repeat if necessary or needed |
<br><br> | <br><br> | ||
| Line 121: | Line 123: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
| + | The single nucleotide polymorphism (SNP), 137852571, that is being examined in this experiment is linked with Androgen Insensitivity Syndrome and Kennedy Spinal and Bulbar Muscular Atrophy. Androgen Insensitivity Syndrome occurs when a person who is genetically male (who has one X and one Y chromosome) is resistant to male hormones (called androgens). As a result, the person has some or all of the physical traits of a female, but the genetic makeup of a male. The mutation on the X chromosome makes the body unable to respond to the hormones that produce a male appearance. Kennedy Spinal and Bulbar Muscular Atrophy is a debilitating neurodegenerative disease resulting in muscle cramps and progressive weakness due to degeneration of motor neurons in the brain stem and spinal cord. The SNP is located on the X chromosome and affects the gene AR, the gene is inherited in an x-linked recessive manner therefore only males can be fully affected by the mutation and females are rarely affected. The sequence of this gene is:<br> | ||
| + | CTTCTCCAGGCTTCCGCAACTTACAC[A/G]TGGACGACCAGATGGCTGTCATTCA<br> | ||
| + | The error in this sequence is represented by [A/G] which means that the normal G base pair has been mutated into an A base pair resulting in an allele that expresses the linked diseases.<br><br> | ||
| + | |||
| + | |||
| + | rs137852571 <Br> | ||
| + | SNP located at:5,255,325 <br> | ||
| + | Missense GTG→ATG <br> | ||
| + | V[Val]→M[Met] <Br> | ||
| + | Chromosome X | ||
| + | <br> | ||
| Line 130: | Line 143: | ||
| + | Normal: G mutates into cancer A<br> | ||
| + | CAACTTACAC<b>A</b>TGGACGACC<bR><Br> | ||
| + | <b>reverse primer:</b><br> | ||
| + | GTTGAATGTGTACCTGCAGG | ||
| + | <br><BR> | ||
| + | <b>Forward primer starts at 5,255,175:</b><br> | ||
| + | AGGGGTGGTGGGGAATTACC | ||
| - | + | '''Illustration'''<br> | |
| - | '''Illustration''' | + | [[Image:Photogroup3.JPG|600x300px]] |
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
| - | + | <b> Bayesian Equation </b> <br><br> | |
| - | + | [[Image:58a49e1877dd22125514b93a41037fb1.png|519×48px]] <br> | |
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
| - | |||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||
| | ||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system that was originally designed by Josh Perfetto and Tito Jankowski.
Key Features
ProtocolsMaterials
PCR Protocol 1.) Pipet 0.1μL of template DNA, 0.5μL of 10μM forward primer, 0.5μL of 10μM reverse primer, 25.0μL of GoTaq Master Mix, and 23.9μL of dH20 in an Eppendorf tube. All of these items mixed together should create a total volume of 50.0μL. DNA Measurement Protocol Fluorimeter Setup Fluorimeter Measurements ImageJ Instructions Research and DevelopmentBackground on Disease Markers The single nucleotide polymorphism (SNP), 137852571, that is being examined in this experiment is linked with Androgen Insensitivity Syndrome and Kennedy Spinal and Bulbar Muscular Atrophy. Androgen Insensitivity Syndrome occurs when a person who is genetically male (who has one X and one Y chromosome) is resistant to male hormones (called androgens). As a result, the person has some or all of the physical traits of a female, but the genetic makeup of a male. The mutation on the X chromosome makes the body unable to respond to the hormones that produce a male appearance. Kennedy Spinal and Bulbar Muscular Atrophy is a debilitating neurodegenerative disease resulting in muscle cramps and progressive weakness due to degeneration of motor neurons in the brain stem and spinal cord. The SNP is located on the X chromosome and affects the gene AR, the gene is inherited in an x-linked recessive manner therefore only males can be fully affected by the mutation and females are rarely affected. The sequence of this gene is:
Normal: G mutates into cancer A |
||||||||||||||||||






