BME103:T130 Group 3

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Serena Kaplan Research and Development Name: Gabe McInnis Open PCR Machine Engineer Name: Blake Eichler Experimental Protocol Planner Name: Sierra Morris Experimental Protocol Planner Name: Zazu Moloi Open PCR Machine Engineer Name: Katelin Vaughn Research and Development LAB 1 WRITE-UP Initial Machine Testing The Original Design A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands. Experimenting With the Connections When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine) Protocols Polymerase Chain Reaction The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences. They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands. Reagent Volume Template DNA (20 ng) 0.1μL 10μM forward primer 0.5μL 10μM reverse primer 0.5μL GoTaq master mix 25.0μL dH2O 23.9μL Total Volume 50.0μL Patient 1 ID 30269 Male, 55 years old Patient 2 ID 22057 Female, 55 years old Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of Thermal Cycling: 1.) 95°C – DNA is unzipped 2.) 57°C – Primers attach at desired sequence 3.) 72°C – Polymerase extends DNA strand by attaching correct nucleotides in order. 4.) Florescent dye is added and then binds to double stranded DNA to detect strands. Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? The cancer gene contains the marker matched with the primer. The non-cancer gene does not contain the marker so therefore the primer does not attach and replication does not occur. Baye’s Rule is then used to allow understanding of the limitations of the tests. Primer: AACTCTTACACTCGATACAT Reliability (Baye's Rule) Equation: (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results Positive Test---------------------------------A1---------------------------------A2---------------------------------A3--------------------------------A4---------------- B1--------------------------------------------B2---------------------------------B3---------------------------------B4--------------------------------H2O---------------- Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control E6 F6 G6 PCR: Positive Control E7 F7 G7 PCR: Patient 1 ID #####, rep 1 E8 F8 G8 PCR: Patient 1 ID #####, rep 2 E9 F9 G9 PCR: Patient 1 ID #####, rep 3 E10 F10 G10 PCR: Patient 2 ID #####, rep 1 E11 F11 G11 PCR: Patient 2 ID #####, rep 2 E12 F12 G12 PCR: Patient 2 ID #####, rep 3 E13 F13 G13 KEY Sample = Integrated Density = DNA μg/mL = Conclusion =