BME103:T130 Group 3

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Serena Kaplan Research and Development Name: Gabe McInnis Open PCR Machine Engineer Name: Blake Eichler Experimental Protocol Planner Name: Sierra Morris Experimental Protocol Planner Name: Zazu Moloi Open PCR Machine Engineer Name: Katelin Vaughn Research and Development LAB 1 WRITE-UP Initial Machine Testing The Original Design A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands. Experimenting With the Connections When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function. Test Run We initially ran the test October 25, 2012 on machine number 3. The machine worked well and we had no problems with it. Protocols Polymerase Chain Reaction The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences. They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands. Reagent Volume Template DNA (20 ng) 0.1μL 10μM forward primer 0.5μL 10μM reverse primer 0.5μL GoTaq master mix 25.0μL dH2O 23.9μL Total Volume 50.0μL Patient 1 ID 30269 Male, 55 years old Patient 2 ID 22057 Female, 55 years old Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction, also known as PCR, is used to reproduce or amplify specific sections of DNA. A PCR machine carries out this reaction synthetically. Components of a PCR reaction: Template DNA: This is the initial strand of DNA used to amplify in the PCR machine. DNA can contain a certain sequence located on a gene that has been linked with having the disease of cancer. Only one copy of this sequence of nucleotides is located in the cell out off around 6 billion individual nucleotides. The purpose of PCR is to locate this strand using a primer and then amplify the sequence. Primer: A reagent that is artificially synthesized DNA sequence that binds specifically to the target sequence of the template DNA, in this case the sequence that is linked with cancer. If the target sequence is not present on the template DNA, then the primer will not bind and amplification will not occur. Taq Polymerase: This is an enzyme that drives DNA replication. Polymerase builds each single strand of DNA marked by a primer into a new, double-stranded DNA segment. It works by finding the ends of the primers, finding free nucleotides from an added solution, then it scans the template DNA to match the proper nucleotides and attaches these nucleotides with hydrogen bonds. The benefit of using Taq Polymerse is that it can withstand extreme temperatures and does not denature during the process of the PCR reaction. Magnesium Chloride: This compound is added to the reaction mixture and binds to the Taq Polymerase, it is used to help the reaction function smoothly and can be adjusted to control the speed of the reaction. dNTP’s: This is the mixture of free bases needed to combine to make new DNA strands that are the product of this reaction. During the thermal cycling three steps occur: 1. The temperature is set to 95 °C which causes the DNA to unzip and the sequences are exposed to the primer. 2. The temperature is set to 57 °C which causes the primer to attach at the desired sequence. 3. The temperature is set to 72 °C which causes the polymerase to extend the DNA strand by attaching the correct free nucleotides in order on a single strand. Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? The cancer gene contains the marker matched with the primer. The non-cancer gene does not contain the marker so therefore the primer does not attach and replication does not occur. Baye’s Rule is then used to allow understanding of the limitations of the tests. Primer: AACTCTTACACTCGATACAT Reliability (Baye's Rule) Explanation: Baye’s Rule analyzes all available data and allows us to understand the limitations of our diagnostic tests. It shows the relationship between conditional probability and its reverse form. Baye’s reasoning can be applied to find the probability of true positives in relation to false positives and false negatives. This allows us to understand how reliable PCR is in detecting cancer sequences in patients. Equation: http://lesswrong.com/lw/774/a_history_of_bayes_theorem/ Known Variables C=cancer present T=positive test P(A|B)=probability of A, given B ~=not Prior Probability p(C)= 1% Conditional Probabilities p(T|C)=80% p(T|~C)=9.6% Proportion of cancer patients with positive results, within the group of ALL patients with positive results: A/(A+C) =80/(80+950) =80/1030 =.078 =7.8% (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results Positive Test---------------------------------A1---------------------------------A2---------------------------------A3--------------------------------A4---------------- B1--------------------------------------------B2---------------------------------B3---------------------------------B4--------------------------------H2O---------------- Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control E6 F6 G6 PCR: Positive Control E7 F7 G7 PCR: Patient 1 ID #####, rep 1 E8 F8 G8 PCR: Patient 1 ID #####, rep 2 E9 F9 G9 PCR: Patient 1 ID #####, rep 3 E10 F10 G10 PCR: Patient 2 ID #####, rep 1 E11 F11 G11 PCR: Patient 2 ID #####, rep 2 E12 F12 G12 PCR: Patient 2 ID #####, rep 3 E13 F13 G13 KEY Sample = Integrated Density = DNA μg/mL = Conclusion =