BME103:T130 Group 3

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Initial Machine Testing)
Line 30: Line 30:
[[Image:PCR Machine (Group 3).png|500px|]]<br>
[[Image:PCR Machine (Group 3).png|500px|]]<br>
-
A Polymerase Chain Reaction (PCR) Machine (in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands.
+
A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands.
'''Experimenting With the Connections'''<br>
'''Experimenting With the Connections'''<br>

Revision as of 17:10, 14 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Serena KaplanResearch and Development
Name: Serena Kaplan
Research and Development
Name: Gabe McInnisOpen PCR Machine Engineer
Name: Gabe McInnis
Open PCR Machine Engineer
Name: Blake EichlerExperimental Protocol Planner
Name: Blake Eichler
Experimental Protocol Planner
Name: Sierra MorrisExperimental Protocol Planner
Name: Sierra Morris
Experimental Protocol Planner
Name: Zazu MoloiOpen PCR Machine Engineer
Name: Zazu Moloi
Open PCR Machine Engineer
Name: Katelin VaughnResearch and Development
Name: Katelin Vaughn
Research and Development

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design



A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands.

Experimenting With the Connections


When the LCD screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function.

Test Run

(Write the date you first tested Open PCR and your experience(s) with the machine)




Protocols

Polymerase Chain Reaction
The DNA samples were heated to ninety-five degrees Celsius for three (3) minutes to unzip the two single strands. They were then cooled to fifty-seven degrees Celsius and the primers were attached to their matching sequences. They were then heated back to seventy-two degrees Celsius and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands.

Reagent Volume
Template DNA (20 ng)0.1μL
10μM forward primer0.5μL
10μM reverse primer0.5μL
GoTaq master mix25.0μL
dH2O23.9μL
Total Volume50.0μL


Patient 1
ID 30269
Male, 55 years old

Patient 2
ID 22057
Female, 55 years old


Flourimeter Measurements


(Add your work from Week 3, Part 2 here)




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

(Add a write-up of the information discussed in Week 3's class)

Processes of Thermal Cycling:

1. 95 degrees celcius – DNA is unzipped
2. 57 degrees celcius – Primers attach at desired sequence
3. 72 degrees celcius – Polymerase extends DNA strand by attaching correct nucleotides in order.
4. Florescent dye is added and binds to double stranded DNA to detect strands.

Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result?
The cancer gene contains the marker matched with the primer. The non-cancer gene does not contain the marker so therefore the primer does not attach and replication does not occur.

Baye’s Rule is then used to allow understanding of the limitations of the tests.


Primer: AACTCTTACACTCGATACAT


(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)




Results



Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control E6 F6 G6
PCR: Positive Control E7 F7 G7
PCR: Patient 1 ID #####, rep 1 E8 F8 G8
PCR: Patient 1 ID #####, rep 2 E9 F9 G9
PCR: Patient 1 ID #####, rep 3 E10 F10 G10
PCR: Patient 2 ID #####, rep 1 E11 F11 G11
PCR: Patient 2 ID #####, rep 2 E12 F12 G12
PCR: Patient 2 ID #####, rep 3 E13 F13 G13


KEY

  • Sample =
  • Integrated Density =
  • DNA μg/mL =
  • Conclusion =


Personal tools