BME103:T130 Group 3
From OpenWetWare
(→Protocols) |
(→Research and Development) |
||
| Line 92: | Line 92: | ||
(Add a write-up of the information discussed in Week 3's class)<br> | (Add a write-up of the information discussed in Week 3's class)<br> | ||
| - | Processes of | + | Processes of Thermal Cycling: |
| - | 1. 95 degrees – DNA is unzipped <br> | + | 1. 95 degrees celcius – DNA is unzipped <br> |
| - | 2. 57 degrees – Primers attach at desired sequence <br> | + | 2. 57 degrees celcius – Primers attach at desired sequence <br> |
| - | 3. 72 degrees – Polymerase extends DNA strand by attaching correct nucleotides in order. <Br> | + | 3. 72 degrees celcius – Polymerase extends DNA strand by attaching correct nucleotides in order. <Br> |
4. Florescent dye is added and binds to double stranded DNA to detect strands. <br> | 4. Florescent dye is added and binds to double stranded DNA to detect strands. <br> | ||
| Line 102: | Line 102: | ||
The cancer gene contains the marker matched with the primer. The non-cancer gene does not contain the marker so therefore the primer does not attach and replication does not occur. <br> | The cancer gene contains the marker matched with the primer. The non-cancer gene does not contain the marker so therefore the primer does not attach and replication does not occur. <br> | ||
| - | Baye’s Rule is used to allow understanding of the limitations of the tests. <br><br> | + | Baye’s Rule is then used to allow understanding of the limitations of the tests. <br><br> |
Revision as of 18:08, 14 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections
Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of Thermal Cycling: 1. 95 degrees celcius – DNA is unzipped Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? Baye’s Rule is then used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
Results
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


