BME103:T130 Group 3: Difference between revisions
(Undo revision 652348 by Gabriel R. McInnis (Talk)) |
|||
Line 91: | Line 91: | ||
(Add a write-up of the information discussed in Week 3's class)<br> | (Add a write-up of the information discussed in Week 3's class)<br> | ||
Processes of thermal cycling: | |||
1. 95 degrees – DNA is unzipped <br> | |||
2. 57 degrees – Primers attach at desired sequence <br> | |||
3. 72 degrees – Polymerase extends DNA strand by attaching correct nucleotides in order. <Br> | |||
4. Florescent dye is added and binds to double stranded DNA to detect strands. <br> | |||
Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? <br> | |||
The cancer gene contains the marker matched with the primer. The non-cancer gene does not contain the marker so therefore the primer does not attach and replication does not occur. <br> | |||
Baye’s Rule is used to allow understanding of the limitations of the tests. <br><br> | |||
<b>Primer:</b> AACTCTTACACTCGATACAT | |||
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) | (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) |
Revision as of 15:29, 8 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections
Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of thermal cycling: 1. 95 degrees – DNA is unzipped Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? Baye’s Rule is used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
Results(Your group will add the results of your Fluorimeter measurements from Week 4 here)
|