BME103:T130 Group 3: Difference between revisions
Line 119: | Line 119: | ||
[[Image:Positivetest.jpg]] | [[Image:Positivetest.jpg]] | ||
[[Image:A1.jpg]] | [[Image:A1.jpg|150px]] | ||
[[Image:A2.jpg]] | [[Image:A2.jpg|150px]] | ||
[[Image:A3.jpg]] | [[Image:A3.jpg|150px]] | ||
[[Image:A4.jpg]] | [[Image:A4.jpg|150px]] | ||
[[Image:B1.jpg]] | [[Image:B1.jpg|150px]] | ||
[[Image:B2.jpeg]] | [[Image:B2.jpeg|150px]] | ||
[[Image:B3.jpeg]] | [[Image:B3.jpeg|150px]] | ||
[[Image:B4.jpeg]] | [[Image:B4.jpeg|150px]] | ||
[[Image:H2O.jpg]] | [[Image:H2O.jpg|150px]] | ||
<!--- Place two small Image J data images here. One showing the result of Water and the other showing the result of Calf Thymus DNA ---> | |||
<!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | |||
{| {{table}} | |||
|- style="background:#f0f0f0;" | |||
| '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | |||
|- | |||
| PCR: Negative Control || E6 || F6 || G6 | |||
|- | |||
| PCR: Positive Control || E7 || F7 || G7 | |||
|- | |||
| PCR: Patient 1 ID #####, rep 1 || E8 || F8 || G8 | |||
|- | |||
| PCR: Patient 1 ID #####, rep 2 || E9 || F9 || G9 | |||
|- | |||
| PCR: Patient 1 ID #####, rep 3 || E10 || F10 || G10 | |||
|- | |||
| PCR: Patient 2 ID #####, rep 1 || E11 || F11 || G11 | |||
|- | |||
| PCR: Patient 2 ID #####, rep 2 || E12 || F12 || G12 | |||
|- | |||
| PCR: Patient 2 ID #####, rep 3 || E13 || F13 || G13 | |||
|} | |||
KEY | |||
* '''Sample''' = <!--- explain what "sample" means ---> | |||
* '''Integrated Density''' = <!--- explain what "integrated density" means and how you did background subtraction to get this value ---> | |||
* '''DNA μg/mL''' = <!--- explain how you calculated this ---> | |||
* '''Conclusion''' = <!--- explain what "Positive" and "No signal" means, relative to the control samples ---> | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Revision as of 14:32, 9 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections
Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of thermal cycling: 1. 95 degrees – DNA is unzipped Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? Baye’s Rule is used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
Results(Your group will add the results of your Fluorimeter measurements from Week 4 here)
|