BME103:T130 Group 3
From OpenWetWare
(→Results) |
Current revision (16:26, 15 November 2012) (view source) |
||
| (47 intermediate revisions not shown.) | |||
| Line 29: | Line 29: | ||
'''The Original Design'''<br> | '''The Original Design'''<br> | ||
| - | A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the | + | A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific Deoxyribose Nucleic Acid (DNA) sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the desired DNA strands. |
'''Experimenting With the Connections'''<br> | '''Experimenting With the Connections'''<br> | ||
| - | When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen | + | When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and the input signals for the LCD screen. Therefore, when the two parts are not connected, the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function. |
'''Test Run''' | '''Test Run''' | ||
| - | + | The initial test was ran on October 25, 2012 on machine number 9. The DNA sample was placed into the PCR machine, closed, and activated. The machine worked well, going through all the test run cycles with relative ease. There were no problems during the test. | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
<br><br> | <br><br> | ||
==Protocols== | ==Protocols== | ||
| - | + | <font size=3><b>Polymerase Chain Reaction</b></font><br><br> | |
| - | The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences. They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands. <br><br> | + | PCR is a method of amplifying a sample of DNA. PCR alters the temperature and allows the DNA to separate, bind to primers, and catalyze. This results in the amount of DNA doubling after each cycle. <br> |
| + | <b>Procedure:</b><br> | ||
| + | 1.) The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. <br> | ||
| + | 2.) They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences. <br> | ||
| + | 3.) They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands. <br><br> | ||
<b>GoTaq Mix Components For 100μl reaction volume:</b><br> | <b>GoTaq Mix Components For 100μl reaction volume:</b><br> | ||
| Line 82: | Line 82: | ||
Female, 55 years old<br> | Female, 55 years old<br> | ||
| + | [[Image:Flourimeter Group 3.jpg|600x300px]]<br><br> | ||
| - | <font size=4>'''Fluorimeter Measurements'''</font><br><br> | + | <font size=3>'''Fluorimeter Setup'''</font><br><br> |
| + | 1.) The lid was first taken off the the box and one of its sides was unbuttoned in order to create a flap.<br> | ||
| + | 2.) The box was the flipped upside down in order to create a dark environment for the camera.<br> | ||
| + | 3.) A hydrophobic slide was then inserted into the flourimeter.<br> | ||
| + | 4.) Finally, the camera phone was placed in the stand. | ||
| + | |||
| + | <font size=3>'''Fluorimeter Measurements'''</font><br><br> | ||
<b>Fluorimeter Assembly Procedure</b><br> | <b>Fluorimeter Assembly Procedure</b><br> | ||
| - | 1.Label transfer pipettes and tubes<br> | + | 1.) Label transfer pipettes and tubes<br> |
| - | 2.Transfer each sample separately into tube containing 400μl of buffer<Br> | + | 2.) Transfer each sample separately into tube containing 400μl of buffer<Br> |
| - | 3.Take the specifically labeled tube containing SYBR GREEN 1 and place 2 drops on the first 2 centered drops <br> | + | 3.) Take the specifically labeled tube containing SYBR GREEN 1 and place 2 drops on the first 2 centered drops <br> |
| - | 4.Place 2 drops of diluted sample on top of the SYBR GREEN 1 drop<br> | + | 4.) Place 2 drops of diluted sample on top of the SYBR GREEN 1 drop<br> |
| - | 5.Align light through drop<br> | + | 5.) Align light through drop<br> |
| - | 6.Take pictures using light box<br> | + | 6.) Take pictures using light box<br> |
| - | 7. Repeat for each sample.<br> | + | 7.) Repeat for each sample.<br> |
| - | 8.Run water as BLANK using same procedure<br> | + | 8.) Run water as BLANK using same procedure<br> |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| + | <b>ImageJ Instructions </b><br> | ||
| + | 1.) Open ImageJ<br> | ||
| + | 2.) Click <b>ANALYZE</b> tool bar and select <b>SET MEASUREMENTS</b><br> | ||
| + | 3.) Select <b>AREA, MEAN GREY VALUE,</b> and<b> INTEGRATED DENSITY</b><br> | ||
| + | 4.) Upload image to ImageJ<br> | ||
| + | 5.) Select <b>IMAGE</b> then <b>COLOR</b> and then <b> SPLIT CHANNELS</b><br> | ||
| + | 6.) Only use green channel<br> | ||
| + | 7.) Use <b>OVAL</b> tool and select the entire drop of liquid<br> | ||
| + | 8.) Go to <b> ANALYZE</b> and then <b>MEASURE</b><br> | ||
| + | 9.) Drag circle to the background of the image <br> | ||
| + | 10.) Record results <br> | ||
| + | 11.) Repeat if necessary | ||
<br><br> | <br><br> | ||
==Research and Development== | ==Research and Development== | ||
| - | + | <b><font size=3>The Underlying Technology</font></b><br> | |
| - | Polymerase Chain Reaction, also known as PCR, is used to reproduce or amplify specific sections of DNA. A PCR machine carries out this reaction synthetically.<br> | + | Polymerase Chain Reaction, also known as PCR, is used to reproduce or amplify specific sections of DNA in large quantities. A PCR machine carries out this reaction synthetically.<br> |
'''Components of a PCR reaction:'''<br> | '''Components of a PCR reaction:'''<br> | ||
| - | ''Template DNA:'' This is the initial strand of DNA | + | ''Template DNA:'' This is the initial strand of DNA amplified in the PCR machine. DNA can contain a certain sequence located on a gene that has been linked to the disease of cancer. Only one copy of this sequence of nucleotides is located in the cell out of around six billion individual nucleotides. The purpose of PCR is to locate this strand using a primer and then amplify the sequence.<br> |
| - | ''Primer:'' A reagent that is artificially synthesized DNA sequence that binds specifically to the target sequence of the template DNA, in this case the sequence that is linked with cancer. If the target sequence is not present on the template DNA, then the primer will not bind and amplification will not occur.<br> | + | ''Primer:'' A reagent that is a artificially synthesized DNA sequence that binds specifically to the target sequence of the template DNA, in this case the sequence that is linked with cancer. If the target sequence is not present on the template DNA, then the primer will not bind and amplification will not occur.<br> |
| - | ''Taq Polymerase:'' This is an enzyme that drives DNA replication. Polymerase builds each single strand of DNA marked by a primer into a new, double-stranded DNA segment. It works by finding the ends of the primers, finding free nucleotides from an added solution, then it scans the template DNA to match the proper nucleotides and attaches these nucleotides with hydrogen bonds. The benefit of using Taq Polymerse is that it can withstand extreme temperatures and does not denature during the process of the PCR reaction.<br> | + | ''Taq Polymerase:'' This is an enzyme that drives DNA replication. Polymerase builds each single strand of DNA marked by a primer into a new, double-stranded DNA segment. It works by finding the ends of the primers, finding free nucleotides from an added solution, and then it scans the template DNA to match the proper nucleotides and attaches these nucleotides with hydrogen bonds. The benefit of using Taq Polymerse is that it can withstand extreme temperatures and does not denature during the process of the PCR reaction.<br> |
''Magnesium Chloride:'' This compound is added to the reaction mixture and binds to the Taq Polymerase, it is used to help the reaction function smoothly and can be adjusted to control the speed of the reaction.<br> | ''Magnesium Chloride:'' This compound is added to the reaction mixture and binds to the Taq Polymerase, it is used to help the reaction function smoothly and can be adjusted to control the speed of the reaction.<br> | ||
''dNTP’s:'' This is the mixture of free bases needed to combine to make new DNA strands that are the product of this reaction.<br> | ''dNTP’s:'' This is the mixture of free bases needed to combine to make new DNA strands that are the product of this reaction.<br> | ||
| - | + | ||
''During the thermal cycling three steps occur:''<br> | ''During the thermal cycling three steps occur:''<br> | ||
| - | 1. The temperature is set to 95 °C which causes the DNA to unzip and the sequences are exposed to the primer.<br> | + | 1.) The temperature is set to 95 °C which causes the DNA to unzip and the sequences are exposed to the primer.<br> |
| - | 2. The temperature is set to 57 °C which causes the primer to attach at the desired sequence.<br> | + | 2.) The temperature is set to 57 °C which causes the primer to attach at the desired sequence.<br> |
| - | 3. The temperature is set to 72 °C which causes the polymerase to extend the DNA strand by attaching the correct free nucleotides in order on a single strand.<br> | + | 3.) The temperature is set to 72 °C which causes the polymerase to extend the DNA strand by attaching the correct free nucleotides in order on a single strand.<br> |
This process is repeated several times to produce huge quantities of the specific piece of DNA that is being examined. By having this enormous amount of DNA, we can accurately test whether or not the patient contains specific markers that indicate that cancer is present in the cells. | This process is repeated several times to produce huge quantities of the specific piece of DNA that is being examined. By having this enormous amount of DNA, we can accurately test whether or not the patient contains specific markers that indicate that cancer is present in the cells. | ||
| Line 142: | Line 145: | ||
<br><br> | <br><br> | ||
| - | + | <b><font size=3>Specific Cancer Marker Detection</font></b><br> | |
The single nucleotide polymorphism (SNP), 17879961, that is being examined in this experiment is known to be linked with breast and colorectal cancer. The SNP is located on the 22nd chromosome and affects the gene checkpoint kinase 2. The sequence of this gene is:<br> GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC<br> | The single nucleotide polymorphism (SNP), 17879961, that is being examined in this experiment is known to be linked with breast and colorectal cancer. The SNP is located on the 22nd chromosome and affects the gene checkpoint kinase 2. The sequence of this gene is:<br> GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC<br> | ||
| - | The error in this sequence is represented by [C/T] which means that the normal T base pair has been mutated into a C base pair resulting in an allele that expresses cancer. | + | The error in this sequence is represented by [C/T] which means that the normal T base pair has been mutated into a C base pair resulting in an allele that expresses cancer.<br> |
| + | The primers associated with this sequence of DNA:<br> | ||
| + | Reverse primer: AACTCTTACACTGCATACAT<br> | ||
| + | Forward primer: TTGAGAATGTGACGTATGTA<br> | ||
| - | + | When these specific primers are placed into a sample of DNA containing the cancer marker SNP 17879961, they will bind to the complimentary base pairs in the marker. The binding of these primers can only occur if the sample DNA contains the exact marker associated with the primer, the binding will result in the amplification of the initial DNA strands. Only the DNA segments with the marker will amplify which will, after many cycles, result in having millions of copies of the segment containing the marker. Therefore, if the patient is negative for this marker, then their DNA will not be amplified and the test will be negative. The presence of amplified DNA means that the patient is positive for the cancer marker. | |
| - | + | <br><br> | |
| - | + | <b><font size=3>Reliability (Baye's Rule)</font> </b><br> | |
| - | + | ||
| - | The | + | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | <b> | + | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | <font size=3>Reliability (Baye's Rule)</font> </b><br> | + | |
<b>Explanation:</b><br>Baye’s Rule analyzes all available data and allows us to understand the limitations of our diagnostic tests. It shows the relationship between conditional probability and its reverse form. Baye’s reasoning can be applied to find the probability of true positives in relation to false positives and false negatives. This allows us to understand how reliable PCR is in detecting cancer sequences in patients. | <b>Explanation:</b><br>Baye’s Rule analyzes all available data and allows us to understand the limitations of our diagnostic tests. It shows the relationship between conditional probability and its reverse form. Baye’s reasoning can be applied to find the probability of true positives in relation to false positives and false negatives. This allows us to understand how reliable PCR is in detecting cancer sequences in patients. | ||
| - | <b>Equation:</b><br>[[Image:Bayes-rule.png|200px|]]<br>http://lesswrong.com/lw/774/a_history_of_bayes_theorem/<br> | + | <b>Equation:</b><br>[[Image:Bayes-rule.png|200px|]]<br>''source:'' http://lesswrong.com/lw/774/a_history_of_bayes_theorem/<br> |
| - | <b>Known Variables</b> | + | <b>Known Variables</b><br> |
C=cancer present<br> T=positive test<br> | C=cancer present<br> T=positive test<br> | ||
P(A|B)=probability of A, given B<br> ~=not | P(A|B)=probability of A, given B<br> ~=not | ||
| Line 184: | Line 175: | ||
=.078 <br> | =.078 <br> | ||
=7.8% <br> | =7.8% <br> | ||
| - | |||
| - | |||
| - | |||
==Results== | ==Results== | ||
| - | + | Positive---------------------------------------Negative<br> | |
| - | + | [[Image:Positivetest.jpg|150px]] [[Image:H2O.jpg|150px]] | |
| - | + | ||
| - | [[Image:Positivetest.jpg|150px]] | + | |
| - | + | ||
| - | + | ||
| - | + | ||
| Line 210: | Line 193: | ||
| PCR: Positive Control || 1344614 || 2.0000 || Positive | | PCR: Positive Control || 1344614 || 2.0000 || Positive | ||
|- | |- | ||
| - | | PCR: Patient 1 ID 30269, rep 1 || 145686 || | + | | PCR: Patient 1 ID 30269, rep 1 || 145686 || 0.2117 || No Signal |
|- | |- | ||
| - | | PCR: Patient 1 ID 30269, rep 2 || 79927 || | + | | PCR: Patient 1 ID 30269, rep 2 || 79927 || 0.1189 || No Signal |
|- | |- | ||
| - | | PCR: Patient 1 ID 30269, rep 3 || 62956 || | + | | PCR: Patient 1 ID 30269, rep 3 || 62956 || 0.0936 || No Signal |
|- | |- | ||
| - | | PCR: Patient 2 ID 22057, rep 1 || | + | | PCR: Patient 2 ID 22057, rep 1 || 189554 || 0.2819 || No Signal |
|- | |- | ||
| - | | PCR: Patient 2 ID 22057, rep 2 || | + | | PCR: Patient 2 ID 22057, rep 2 || 114638 || 0.1705 || No Signal |
|- | |- | ||
| - | | PCR: Patient 2 ID 22057, rep 3 || | + | | PCR: Patient 2 ID 22057, rep 3 || 126718 || 0.1885 || No Signal |
|} | |} | ||
KEY | KEY | ||
| - | * '''Sample''' = | + | * '''Sample''' = Sample Deoxyribose Nucleic Acid (DNA) from the patient. |
| - | * '''Integrated Density''' = | + | * '''Integrated Density''' = The integrated density (INTDEN) was calculated by subtracting the INTDEN of the drop from the INTDEN of the backround. |
| - | * '''DNA μg/mL''' = | + | * '''DNA μg/mL''' = The DNA concentration was calculated by diving the INTDEN of the selected sample by INTDEN of the positive control and the multiplying by the DNA concentration of the positive control |
| - | * '''Conclusion''' = < | + | * '''Conclusion''' = <b>Positive</b> signal means the sample glowed green and cancer was present. <b>No sample</b> was a clear result and resulted in no cancer being present. |
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Current revision
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing
A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific Deoxyribose Nucleic Acid (DNA) sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the desired DNA strands. Experimenting With the Connections When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and the input signals for the LCD screen. Therefore, when the two parts are not connected, the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function. Test Run The initial test was ran on October 25, 2012 on machine number 9. The DNA sample was placed into the PCR machine, closed, and activated. The machine worked well, going through all the test run cycles with relative ease. There were no problems during the test.
ProtocolsPolymerase Chain Reaction GoTaq Mix Components For 100μl reaction volume:
Patient 2 Fluorimeter Setup Fluorimeter Measurements
ImageJ Instructions Research and DevelopmentThe Underlying Technology Polymerase Chain Reaction, also known as PCR, is used to reproduce or amplify specific sections of DNA in large quantities. A PCR machine carries out this reaction synthetically. Components of a PCR reaction: Primer: A reagent that is a artificially synthesized DNA sequence that binds specifically to the target sequence of the template DNA, in this case the sequence that is linked with cancer. If the target sequence is not present on the template DNA, then the primer will not bind and amplification will not occur. Taq Polymerase: This is an enzyme that drives DNA replication. Polymerase builds each single strand of DNA marked by a primer into a new, double-stranded DNA segment. It works by finding the ends of the primers, finding free nucleotides from an added solution, and then it scans the template DNA to match the proper nucleotides and attaches these nucleotides with hydrogen bonds. The benefit of using Taq Polymerse is that it can withstand extreme temperatures and does not denature during the process of the PCR reaction. Magnesium Chloride: This compound is added to the reaction mixture and binds to the Taq Polymerase, it is used to help the reaction function smoothly and can be adjusted to control the speed of the reaction. dNTP’s: This is the mixture of free bases needed to combine to make new DNA strands that are the product of this reaction. During the thermal cycling three steps occur: This image illustrates the process described above: Specific Cancer Marker Detection The single nucleotide polymorphism (SNP), 17879961, that is being examined in this experiment is known to be linked with breast and colorectal cancer. The SNP is located on the 22nd chromosome and affects the gene checkpoint kinase 2. The sequence of this gene is: When these specific primers are placed into a sample of DNA containing the cancer marker SNP 17879961, they will bind to the complimentary base pairs in the marker. The binding of these primers can only occur if the sample DNA contains the exact marker associated with the primer, the binding will result in the amplification of the initial DNA strands. Only the DNA segments with the marker will amplify which will, after many cycles, result in having millions of copies of the segment containing the marker. Therefore, if the patient is negative for this marker, then their DNA will not be amplified and the test will be negative. The presence of amplified DNA means that the patient is positive for the cancer marker.
Equation: Conditional Probabilities ResultsPositive---------------------------------------Negative
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



