BME103:T130 Group 2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Alexandra Brunelle Research and Development Specialist Name: Charul Singh Experimental Protocol Planner Name: Alex Hoffmann Experimental Protocol Planner Name: AJ Ciferno Open PCR Machine Engineer Name: Haley Gjertsen Research and Development Specialist Name: student Role(s) LAB 1 WRITE-UP Initial Machine Testing The Original Design Experimenting With the Connections When we unplugged the LCD screen from the PCR machine, the machine's display screen stopped working, but information continued to transmit to the computer. When we unplugged the white wire that connects the Thermocouple to the 16-tube PCR block, the machine's temperature measurement was disabled/no longer kept track of heat readings. Test Run (October 18th, 20th): Responded normally, no signs of malfunction Protocols Polymerase Chain Reaction Reagent Volume Template DNA (20 ng) 0.2 µL 10 µM forward primer 1.0 µL 10 µM reverse primer 1.0 µL GoTaq master mix 50.0 µL dH20 47.8µL Total Volume 100.0 µL Sample Descriptions Sample 1: Positive Control (contains cancer DNA template), Tube label: P Sample 2: Negative Control (no DNA template), Tube label: N Patient 1 ID 74013, Male, Age 55 Sample 3: Patient 74013, Replicate 1. Tube label M1 Sample 4: Patient 74013, Replicate 2. Tube label M2 Sample 5: Patient 74013, Replicate 3. Tube label M3 Patient 2 ID: 72825, Female, Age 55 Sample 6: Patient 72825, Replicate 1. Tube label F1 Sample 7: Patient 72825, Replicate 2, Tube label F2 Sample 8: Patient 72825, Replicate 3, Tube label F3 Set up PCR: Label each tube differently and record label. Insert reactants into their respective PCR tube. Connect assembled PCR machine to a computer. Customize settings in program to two stages: - Stage 1: One cycle, heat to 95 degrees Celcius for 3 minutes - Stage 2: 35 cycles, heat to 95 degrees Celsius for 30 seconds; cool to 57 degrees Celcius for 30 seconds; heat to 72 degrees Celcius for 30 seconds. Start up the OpenPCR program previously installed on the computer. Place tubes in slots in PCR machine and close lid tightly. Lower the top of the lid until it just touches tops of tubes. Press "Start" to run the PCR machine. Record data. Flourimeter Measurements (Add your work from Week 3, Part 2 here) Flourimeter Assembly Procedures: 1. Place the slide (glass facing down) onto the device. 2. Using a pipette place two drops of solution onto the center line two dots. 3. Switch on the blue light and adjust slide to allow the light to shine through the solution drops. 4. Now adjust the settings on the smart phone: no flash, contrast on the lowest setting, saturation on the highest setting and exposure on the highest setting 5. Place the phone in the holder facing the device. (should be about two inches away) 6. Cover the device and the phone and holder with the black box to keep out light. 7. Take picture. For best results, set a timer on the phone to be able to close the box and maximize darkness. Research and Development Specific Cancer Marker Detection - The Underlying Technology PCR stands for Polymerase Chain Reaction. This reaction is used to amplify a specific segment of DNA that codes for cancer. Some basic components involved in a PCR reaction are: Template DNA: the original strand of DNA that is going to be copied Primers: attach to the sites on the DNA strands that are at either end of the template DNA, they drive the PCR because they are powerful enzymes that drive replication (if they are able to attach the patient is negative for cancer) Taq Polymerase: reads the DNA code and matches new nucleotides with the template strand, it bind the pairs together with hydrogen bonds (example: A-T, C-G) These base pairs make it possible to make several copies of the DNA strands. Magnesium Chloride: a three atom molecule that binds to Taq polymerase as a cofactor to help it function properly dNTP's: deoxinucleotide triphosphate, they are the new nucleotides A PCR functions by going through a series of thermal cycles: In the first cycle the PCR machine heats up to 95 degrees Celsius. This unzips the DNA strand creating two separate DNA strand molecules and exposes the nucleotides we wish to look at. In the second cycle the temperature drops to 57 degrees Celsius which allows the primase to bind to the ends of the DNA strands. The third cycle heats up the DNA to 72 degrees Celsius to allow DNA replication by the enzyme Taq polymerase. These three cycles are repeated many more times, allowing for billions of DNA copies to be made. We need multiple copies of the DNA so that we can see if the patient tests positive for cancer. r17879961 The single nucleotide polymorphism, or SNP, that codes for cancer is AACTCTTACACTCGATACAT; in a normal patient, the C is replaced with T. The reason the C causes cancer in a patient is because there is an improper base pair, causing the primers not to bind resulting in single strands forming (C does does not code with A). After the PCR's thermal cycles are finished the cancerous patient's DNA will be single stranded and we will be able to see this after fluorescent dye is added and nothing appears. The fluorescent dye only expresses the double stranded, non-cancerous patients. Below is a visual representation of what happens during a Polymerase Chain Reaction: 1. DNA Primers and tag polymerase is added to a section of DNA targeted for replication 2. As the temperature is heated to 95 degrees Celsius, the strand denatures 3. Then, the temperature cools, making the strands want to rebind. However, because there are many more primers than strands, the primers are able to attach to the front of each strand. 4. Next, the DNA is heated to 72 degrees to allow DNA replication to occur. 5. In order to produce many copies of this strand for analysis, steps 2-4 are repeated many times. Results DNA Concentration Based on INTDEN Description INTDEN w/ background subtracted DNA Concentration, microg/ml Water Blank 525630 0 DNA Calf Thymus, 2microg/ml 2372315 2 P 2121336 1.788410055 M1 -57048 -.048094793 M2 1436979 1.211457163 M3 2803635 2.363627933 N 76818 .064762057 F1 140996 .118867857 F2 74969 .063203242 F3 2880430 2.4283706 Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control E6 F6 G6 PCR: Positive Control E7 F7 G7 PCR: Patient 1 ID #####, rep 1 E8 F8 G8 PCR: Patient 1 ID #####, rep 2 E9 F9 G9 PCR: Patient 1 ID #####, rep 3 E10 F10 G10 PCR: Patient 2 ID #####, rep 1 E11 F11 G11 PCR: Patient 2 ID #####, rep 2 E12 F12 G12 PCR: Patient 2 ID #####, rep 3 E13 F13 G13 KEY Sample = Integrated Density = DNA μg/mL = Conclusion =