BME103:T130 Group 1 l2
From OpenWetWare
(→Research and Development) |
(→Research and Development) |
||
| Line 130: | Line 130: | ||
'''Primer Design''' | '''Primer Design''' | ||
| - | + | ||
| + | The forward primer for this disease is ACTCCGGACCCGTCCAACCAT and the reverse primer for a patient without sickle-cell disease would be TGAGGCCTGGGCAGGGTTGGTA. If a patient were to be positive for sickle-cell disease, | ||
Revision as of 22:30, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||
| | |||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Instructions
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers The disease marker being used is SNP rs35685286. This is the marker for sickle-cell disease found on chromosome 11. Patients with sickle-cell disease have red blood cells that are mishapen and are a "sickled" or crescent shape. This results in less oxygen being carried to the patient's body tissues. Therefore, patients experience crisis, where they have severe pain in their bones in their backs or chest. These symptoms can last for hours or even days. More information about this particular SNP can be found at: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286
| |||||||||||||||||||||||||||||||


