BME103:T130 Group 17 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
(14 intermediate revisions by 4 users not shown)
Line 9: Line 9:
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->


=OUR TEAM=
=GROUP 17=


{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
Line 20: Line 20:
|}
|}


=LAB 2 WRITE-UP=
=LAB 2 WRITE-UP: Redesigning Open PCR for Autism Detection=




Line 72: Line 72:
|Pre-labeled bulb pipets || 34 pipets
|Pre-labeled bulb pipets || 34 pipets
|-
|-
|20 µM forward primer (ALZ) || 2.0 μL
|20 µM forward primer (Autism) || 2.0 μL
|-
|-
|20 µM reverse primer (ALZ) || 2.0 μL
|20 µM reverse primer (Autism) || 2.0 μL
|-
|-
|GoTaq Master Mix || 100.0 μL
|GoTaq Master Mix || 100.0 μL
Line 102: Line 102:
2.  Put the DNA into the special PCR tube.
2.  Put the DNA into the special PCR tube.


3.  Add forward primer (ALZ) to the PCR tube with the DNA.
3.  Add forward primer (Autism) to the PCR tube with the DNA.


4.  Add reverse primer (ALZ) to the PCR tube with DNA.
4.  Add reverse primer (Autism) to the PCR tube with DNA.


5.  Add Nucleotides (the A,C,T,and G).
5.  Add Nucleotides (the A,C,T,and G).
Line 182: Line 182:




'''Primer Design'''
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
 
'''Autism Primer Design'''  
 
DNA Sequence: CCTCAAATGATTATTTAGATCCAGAA[G/T]ATAGAAAGTTTTTGGAAAGTTATGC


<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. --->
Alleles: [G/T]
Allele Change:  '''T'''AT '''-->''' '''G'''AT


Forward Primer: 3' AGAAACTAGTAGTAACTTCC 5'


Reverse Primer: 3' AGATCCAGAAGATAGAAAGTT 5'


The allele change is from T to G, which will be replicated in the PCR because the primer design is constructed to detect this specific mutation. Detecting the allele change signifies that this is a positive sample, in other words Autism is likely to develop in the patient. If the allele change had not occurred, the PCR will not replicate this gene at full out. The positive reading has shows an exponential growth while the negative one is more linear, essentially the difference between the positive and negative strands is quite obvious in the number of replications that each of them produce.


'''Illustration'''
'''Illustration'''


[[Image:PCR-process.gif]]
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP --->


'''Bayes Rule'''
[[Image:bayes-rule.png]]
P(A|B) is the probability that Autism will occur in a positive sample (PCR Test Result). P(B|A)is the probability that child will test positive for Autism. P(A) is the probability of having Autism in the mutation and P(B) is the probability of humans without the Autism mutation that could yield positive results. 


<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Latest revision as of 23:36, 29 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

GROUP 17

Jorge Jimenez
Research Development Specialist
Ricardo Robles
Research Development Specialist
Jennifer Begin
Experimental Protocol Planner
Finola Roy
Experimental Protocol Planner
Kevin Zenner
Open PCR Machine Engineer

LAB 2 WRITE-UP: Redesigning Open PCR for Autism Detection

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design
Image of the heating block

Image of the cooling system


Key Features
The first picture shows the heating block that is in use in the current PCR machine. It is limited in that it can only contain 16 test tubes at any given time. Our redesign calls for doubling the amount of test tube holders by increasing the size of the heating block. The picture below is that of the current cooling system. Because our redesign is going the be running PCR on twice as many samples, an increase in the cooling power needs to occur in order to sufficiently cool the larger number of samples. This is done by increasing the size of the cooling system and therefore increasing its power.


Instructions
1) Remove the current heating block and cooling system from the PCR machine.
2) Replace removed items with the larger heating block and larger cooling system.
3) Replace side panels with larger ones in case any of the replaced parts exceed the confines of the current PCR machine.
4) Continue to run PCR as normal.




Protocols

Material Tables

Supplied in the Kit Amount
Pre-labeled PCR tubes 32 tubes
Pre-labeled bulb pipets 34 pipets
20 µM forward primer (Autism) 2.0 μL
20 µM reverse primer (Autism) 2.0 μL
GoTaq Master Mix 100.0 μL
dH2O 95.6 μL
Total Volume 199.6 μL
Supplied by the user Amount
DNA (40 ng) 0.4 μL
Computer 1
Lab coats 1 per person
gloves 2 per person

PCR Protocol Step by Step instruction to amplify the Patient's DNA Sample:

1. Need to extract the DNA from the patient.

2. Put the DNA into the special PCR tube.

3. Add forward primer (Autism) to the PCR tube with the DNA.

4. Add reverse primer (Autism) to the PCR tube with DNA.

5. Add Nucleotides (the A,C,T,and G).

6. Add the DNA polymerase to the PCR tube.

7. Place the PCR tube into the thermal cycler.

8. Set the temperature of the thermal cycler to 95°C and set the machine to run 30 cycles.

9. Now the thermal cycler cools down to 50°C and forward and reverse primer attach to the single strands of DNA.

10. Now the thermal cycler temperature changes to 72°C. This begins the DNA polymerase. This pairs the DNA with its complimentary nucleotide through to the end of the DNA strand.

11. Repeat step 8-10 29 more times.

12. During cycle #3 the wanted DNA begins to appear.

13. The wanted piece of the DNA begins to double.

14. After 30 cycles are complete over a billion wanted DNA fragments will show in the DNA solution and there will be 60 copies of unwanted DNA molecules in the solution.



DNA Measurement Protocol

1. Turn on the blue light in the Flourimeter using the switch for the Blue LED.

2. Place the smart phone in the cradle provided at the right angle and distance from the slide.

3. Turn on the camera on the phone. TURN OFF THE FLASH. Set the ISO to 800 or higher. Increase the exposure to maximum.

4. Adjust the distance between phone and the first two rows of dots of the slide so that the picture will be clear and the camera does not give a blurred image.

5.First label the blank pipettes according to the patients (A,B,C,D... all eight of them). The pipettes given by the instructor are color coded. The white coded pipette is used for water. the red coded pipette is used for the calibrator (the tube with the red dot). The blue coded pipette is used for the sybrgreen (the tube with the blue dot). The black coded pipette is used to pick up the waste and put it in the cup that collects the waste droplets.

6. Align the slide so that the blue dot passed between the first two dots on the slide in the middle column. First calibrate the machine (to make sure the machine works). To calibrate the machine first put two drops of water on each dot and if the droplets are not connected then add a third droplet to combine the two separate droplets to one droplet. Put two droplets of the cyber green on the first two dots in the middle.

7. Then set the smart phone accordingly to take a clear picture of the droplet. Then put the black box on top of the phone and the machine so that when the the light is completely blocked and the shade of blue of green is shown when the picture is taken.

8. Record observations.

9. Remove the solution from the glass dish using the black pipette and discard it in the plastic cup given for the waste droplets.

10.Repeat step 6-9, but instead of adding calibrator solution, add 2 droplets of water.

11.Repeat steps 6-9 for patient 1 solutions (A,B,C,D) and patient 2 solutions (A2.B2,C2,D2).

Research and Development

Background on Disease Markers


The disease we chose to analyze was the gene mutation for Autism. Autism is a condition associated with abnormal biology and chemistry in the brain. Although the origin of the abnormalities remain unknown, genetic factors seem to carry some importance. The signs of Autism are seen at 18 months and usually go without any help until the child is 2 years old. Autism mainly causes children to have trouble in social interactions including verbal and non verbal communication. Some actions of children with Autism are unusual distress when routines are changed, heightened or low senses, and extreme tantrums. (Johnson & Myers, 2007).



Source: Johnson CP, Myers SM; American Academy of Pediatrics Council on Children with Disabilities. Identification and evaluation of children with autism spectrum disorders. Pediatrics. 2007;120:1183-1215.


NCBI gave the mutation at Chromosome X, which is one of the two sex determining chromosomes.

rs122468182 [Homo sapiens]

CCTCAAATGATTATTTAGATCCAGAA[G/T]ATAGAAAGTTTTTGGAAAGTTATGC

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=122468182



Autism Primer Design

DNA Sequence: CCTCAAATGATTATTTAGATCCAGAA[G/T]ATAGAAAGTTTTTGGAAAGTTATGC

Alleles: [G/T] Allele Change: TAT --> GAT

Forward Primer: 3' AGAAACTAGTAGTAACTTCC 5'

Reverse Primer: 3' AGATCCAGAAGATAGAAAGTT 5'

The allele change is from T to G, which will be replicated in the PCR because the primer design is constructed to detect this specific mutation. Detecting the allele change signifies that this is a positive sample, in other words Autism is likely to develop in the patient. If the allele change had not occurred, the PCR will not replicate this gene at full out. The positive reading has shows an exponential growth while the negative one is more linear, essentially the difference between the positive and negative strands is quite obvious in the number of replications that each of them produce.

Illustration


Bayes Rule

P(A|B) is the probability that Autism will occur in a positive sample (PCR Test Result). P(B|A)is the probability that child will test positive for Autism. P(A) is the probability of having Autism in the mutation and P(B) is the probability of humans without the Autism mutation that could yield positive results.