BME103:T130 Group 17 - Revision history

Ricardo Robles: /* Research and Development */

Ricardo Robles — Thu, 15 Nov 2012 08:19:46 GMT

Research and Development

←Older revision		Revision as of 08:19, 15 November 2012
Line 168:		Line 168:
	'''Specific Cancer Marker Detection - The Underlying Technology'''<br>		'''Specific Cancer Marker Detection - The Underlying Technology'''<br>

-	The r17879961 sequence will produce a cancer mutation at Chromosomes 22 of the gene sequence. The normal sequence has a T ( ~~thymine~~) nucleotide at chromosome 22 while the mutation sequence has an associated C (cytosine) nucleotide. ~~The~~ Open PCR machine ~~is able to determine~~ whether or not the r17879961 sample ~~has cancer by replicating~~ the ~~desired mutation exponentially~~. Positive and negative strands are inserted into the PCR with a certain primer. The primer in the reaction ~~is designed to~~ attach to the C nucleotide that ~~signifies cancer mutation. One strand has the primer, while the other strand does not~~. Open PCR will replicate the ~~strand~~ with the ~~certain~~ primer, ~~causing an~~ exponential growth. The negative strand will grow in a linear fashion. The PCR process goes through 30 cycles ~~to complete this. After~~ the PCR process, fluorescent dye is added to the solutions. The fluorescent dye ~~will cause~~ the DNA ~~with double strands~~ to glow. Since the PCR has grown the double stranded positive DNA exponentially the fluorescent dye ~~glows brighter~~. Therefore the ~~cancer~~ DNA is in the sample ~~with the~~ glow.<br>	+	The r17879961 sequence will produce a cancer mutation at Chromosomes 22 of the gene sequence. The normal sequence has a T (Thymine) nucleotide at chromosome 22, while the mutation sequence has an associated C (cytosine) nucleotide. With the replication that occurs in the Open PCR machine, determining whether or not the r17879961 sample is cancerous is possible for there will be an exponential growth of the DNA sample if positive. A negative result will show a significantly smaller amount of replicated DNA; graphically this appears as a linear growth. Positive and negative strands are inserted into the PCR with a certain primer. The primer in the reaction will attach to the C nucleotide, which signifies that it is cancerous. Open PCR will attempt to replicate both strands, however, since only one of the DNA samples will be able to fully replicate with the primer, that is the one in which exponential growth can be noted. The negative strand will grow in a linear fashion, for it is only replicating one strand instead of both. The PCR process goes through 30 cycles; after the PCR process is complete, fluorescent dye is added to the solutions. The fluorescent dye causes the DNA to glow. Since the PCR has grown the double stranded positive DNA exponentially the fluorescent dye will be more noticeable in the cancerous strand in comparison to the negative strand which will have strands glowing just not as much as the positive sample. Therefore the cancerous DNA is in the sample that has most glow.<br>

Jorge Jimenez: /* Protocols */

Jorge Jimenez — Thu, 15 Nov 2012 07:01:30 GMT

Protocols

←Older revision		Revision as of 07:01, 15 November 2012
Line 164:		Line 164:
	<br><br>		<br><br>

-	~~'''Bold text'''~~==Research and Development==	+	==Research and Development==

	'''Specific Cancer Marker Detection - The Underlying Technology'''<br>		'''Specific Cancer Marker Detection - The Underlying Technology'''<br>
Line 195:		Line 195:
	Source: Genetic Science Learning Center (2012, August 6) PCR Virtual Lab. Learn.Genetics. Retrieved November 8, 2012, from http://learn.genetics.utah.edu/content/labs/pcr/		Source: Genetic Science Learning Center (2012, August 6) PCR Virtual Lab. Learn.Genetics. Retrieved November 8, 2012, from http://learn.genetics.utah.edu/content/labs/pcr/

-	~~'''Bayesian Theorem'''<br>~~

-	~~[[Image:‎bayes-rule.png\|200px\|Seventh Step]]~~
-	~~<br><br>~~

	'''The r17879961 sequence:'''		'''The r17879961 sequence:'''
Line 220:		Line 217:

	p(CIT) = (p(TIC)p(C))/((P(TIC)p(C)) +((p(TI~C)*p(~C)))		p(CIT) = (p(TIC)p(C))/((P(TIC)p(C)) +((p(TI~C)*p(~C)))
		+
		+	'''Bayesian Theorem'''<br>
		+
		+	[[Image:‎bayes-rule.png\|200px\|Seventh Step]]
		+	<br><br>

	==Results==		==Results==

Jorge Jimenez: /* Research and Development */

Jorge Jimenez — Thu, 15 Nov 2012 06:56:51 GMT

Research and Development

←Older revision		Revision as of 06:56, 15 November 2012
Line 164:		Line 164:
	<br><br>		<br><br>

-	==Research and Development==	+	'''Bold text'''==Research and Development==

	'''Specific Cancer Marker Detection - The Underlying Technology'''<br>		'''Specific Cancer Marker Detection - The Underlying Technology'''<br>
Line 199:		Line 199:
	[[Image:‎bayes-rule.png\|200px\|Seventh Step]]		[[Image:‎bayes-rule.png\|200px\|Seventh Step]]
	<br><br>		<br><br>
		+
		+	'''The r17879961 sequence:'''
		+
		+	GGAAGTGGGTCCTAAAAACTCTTACA[T/C]TGCATACATAGAAGATCACAGTGGC
		+
		+	Normal has T at Chromosome 22
		+
		+	Mutation has C at Chromosome 22
		+
		+	Forward:
		+
		+	CCTTCACCCAGGATTTTTGAG
		+
		+	Backward:
		+
		+	ATGTATCTTCTAGTGTCACCG
		+
		+
		+	'''Baye's Equation:'''
		+
		+	p(CIT) = (p(TIC)p(C))/((P(TIC)p(C)) +((p(TI~C)*p(~C)))

	==Results==		==Results==

Kevin Zenner: /* Research and Development */

Kevin Zenner — Thu, 15 Nov 2012 06:42:02 GMT

Research and Development

←Older revision		Revision as of 06:42, 15 November 2012
Line 194:		Line 194:

	Source: Genetic Science Learning Center (2012, August 6) PCR Virtual Lab. Learn.Genetics. Retrieved November 8, 2012, from http://learn.genetics.utah.edu/content/labs/pcr/		Source: Genetic Science Learning Center (2012, August 6) PCR Virtual Lab. Learn.Genetics. Retrieved November 8, 2012, from http://learn.genetics.utah.edu/content/labs/pcr/
		+
		+	'''Bayesian Theorem'''<br>
		+
		+	[[Image:‎bayes-rule.png\|200px\|Seventh Step]]
	<br><br>		<br><br>

Kevin Zenner: /* Results */

Kevin Zenner — Thu, 15 Nov 2012 06:10:21 GMT

Results

←Older revision		Revision as of 06:10, 15 November 2012
Line 227:		Line 227:
	KEY		KEY
	* '''Sample''' = Excluding the positive and negative controls, a sample consisted of three to five drops of sybrgreen dye overlaid with two drops of a DNA set. <!--- explain what "sample" means --->		* '''Sample''' = Excluding the positive and negative controls, a sample consisted of three to five drops of sybrgreen dye overlaid with two drops of a DNA set. <!--- explain what "sample" means --->
-	* '''Integrated Density''' = The sum of the mean grey value of each of the pixels in an image. The final INTDEN value was obtained by subtracting the background INTDEN value of an image from the INTDEN value of the drop in the image. <!--- explain what "integrated density" means and how you did background subtraction to get this value --->	+	* '''Integrated Density''' = The sum of the mean grey value of each of the pixels in an image. The final INTDEN value was obtained by subtracting the background INTDEN value of the image from the INTDEN value of the drop in the image. <!--- explain what "integrated density" means and how you did background subtraction to get this value --->
	* '''DNA μg/mL''' = This value was calculated by dividing INTDEN value of the positive control by the INTDEN value of a specific DNA sample, then multiplying by 2 μg/mL.<!--- explain how you calculated this --->		* '''DNA μg/mL''' = This value was calculated by dividing INTDEN value of the positive control by the INTDEN value of a specific DNA sample, then multiplying by 2 μg/mL.<!--- explain how you calculated this --->
	* '''Conclusion''' = Positive and negative essentially states whether or not cancer is present in the DNA sample.<!--- explain what "Positive" and "No signal" means, relative to the control samples --->		* '''Conclusion''' = Positive and negative essentially states whether or not cancer is present in the DNA sample.<!--- explain what "Positive" and "No signal" means, relative to the control samples --->

Kevin Zenner: /* Protocols */

Kevin Zenner — Thu, 15 Nov 2012 06:08:02 GMT

Protocols

←Older revision		Revision as of 06:08, 15 November 2012
Line 47:		Line 47:
	'''Polymerase Chain Reaction'''<br>		'''Polymerase Chain Reaction'''<br>

-	The PCR replicated the wanted DNA fragments from the patient. The PCR will heat up to ~~95 degree Celsius~~ and cool down to 50°C. Then heat back up to 72°C within one cycle. Over all there will be 30 cycles. At the end of the 30 cycles we have over a billion of the wanted fragments, and 60 unwanted DNA molecule strands in the solution.	+	The PCR replicated the wanted DNA fragments from the patient. The PCR will heat up to 95°C and cool down to 50°C. Then heat back up to 72°C within one cycle. Over all there will be 30 cycles. At the end of the 30 cycles we have over a billion of the wanted fragments, and 60 unwanted DNA molecule strands in the solution.

	'''Step by Step instruction to amplify the Patient's DNA Sample:'''		'''Step by Step instruction to amplify the Patient's DNA Sample:'''

Kevin Zenner: /* Initial Machine Testing */

Kevin Zenner — Thu, 15 Nov 2012 06:06:31 GMT

Initial Machine Testing

←Older revision		Revision as of 06:06, 15 November 2012
Line 26:		Line 26:

	'''The Original Design'''<br>		'''The Original Design'''<br>
-	Pictured here is an inside view of the Open Polymerase Chain Reaction (PCR) machine used to conduct the experiment. Open PCR works in a series of temperature controlled cycles that both heat and cool samples of DNA in order to duplicate certain segments of it. When the samples of DNA are heated or cooled to ~~specific~~ temperatures, primers and free-floating nucleotides in the DNA solution work to copy ~~specific~~ sequences of DNA. This is done so that the amplified DNA sequences make it possible to diagnose ~~certain~~ diseases, or in the case of this experiment cancer.<br>	+	Pictured here is an inside view of the Open Polymerase Chain Reaction (PCR) machine used to conduct the experiment. Open PCR works in a series of temperature controlled cycles that both heat and cool samples of DNA in order to duplicate certain segments of it. When the samples of DNA are heated or cooled to specified temperatures, primers and free-floating nucleotides in the DNA solution work to copy certain sequences of DNA. This is done so that the amplified DNA sequences make it possible to diagnose some diseases, or in the case of this experiment cancer.<br>
	[[Image:PCR_Machine.png\|200px\|Image of the Open PCR]]		[[Image:PCR_Machine.png\|200px\|Image of the Open PCR]]

Kevin Zenner: /* Initial Machine Testing */

Kevin Zenner — Thu, 15 Nov 2012 05:57:34 GMT

Initial Machine Testing

←Older revision		Revision as of 05:57, 15 November 2012
Line 26:		Line 26:

	'''The Original Design'''<br>		'''The Original Design'''<br>
-	Pictured here is an inside view of the Open Polymerase Chain Reaction (PCR) machine used to conduct the experiment. Open PCR works in a series of temperature controlled cycles that both heat and cool samples of DNA in order to duplicate certain segments of it. When the samples of DNA are heated or cooled to ~~certain~~ temperatures, primers and free-floating nucleotides in the DNA solution work to copy specific sequences of DNA. This is done so that the amplified DNA sequences make it possible to diagnose certain diseases, or in the case of this experiment cancer.<br>	+	Pictured here is an inside view of the Open Polymerase Chain Reaction (PCR) machine used to conduct the experiment. Open PCR works in a series of temperature controlled cycles that both heat and cool samples of DNA in order to duplicate certain segments of it. When the samples of DNA are heated or cooled to specific temperatures, primers and free-floating nucleotides in the DNA solution work to copy specific sequences of DNA. This is done so that the amplified DNA sequences make it possible to diagnose certain diseases, or in the case of this experiment cancer.<br>
	[[Image:PCR_Machine.png\|200px\|Image of the Open PCR]]		[[Image:PCR_Machine.png\|200px\|Image of the Open PCR]]

Kevin Zenner: /* Results */

Kevin Zenner — Thu, 15 Nov 2012 02:52:38 GMT

Results

←Older revision		Revision as of 02:52, 15 November 2012
Line 226:		Line 226:

	KEY		KEY
-	* '''Sample''' = <!--- explain what "sample" means --->	+	* '''Sample''' = Excluding the positive and negative controls, a sample consisted of three to five drops of sybrgreen dye overlaid with two drops of a DNA set. <!--- explain what "sample" means --->
-	* '''Integrated Density''' = <!--- explain what "integrated density" means and how you did background subtraction to get this value --->	+	* '''Integrated Density''' = The sum of the mean grey value of each of the pixels in an image. The final INTDEN value was obtained by subtracting the background INTDEN value of an image from the INTDEN value of the drop in the image. <!--- explain what "integrated density" means and how you did background subtraction to get this value --->
-	* '''DNA μg/mL''' = <!--- explain how you calculated this --->	+	* '''DNA μg/mL''' = This value was calculated by dividing INTDEN value of the positive control by the INTDEN value of a specific DNA sample, then multiplying by 2 μg/mL.<!--- explain how you calculated this --->
-	* '''Conclusion''' = <!--- explain what "Positive" and "No signal" means, relative to the control samples --->	+	* '''Conclusion''' = Positive and negative essentially states whether or not cancer is present in the DNA sample.<!--- explain what "Positive" and "No signal" means, relative to the control samples --->

Kevin Zenner: /* Initial Machine Testing */

Kevin Zenner — Thu, 15 Nov 2012 01:46:20 GMT

Initial Machine Testing

←Older revision		Revision as of 01:46, 15 November 2012
Line 27:		Line 27:
	'''The Original Design'''<br>		'''The Original Design'''<br>
	Pictured here is an inside view of the Open Polymerase Chain Reaction (PCR) machine used to conduct the experiment. Open PCR works in a series of temperature controlled cycles that both heat and cool samples of DNA in order to duplicate certain segments of it. When the samples of DNA are heated or cooled to certain temperatures, primers and free-floating nucleotides in the DNA solution work to copy specific sequences of DNA. This is done so that the amplified DNA sequences make it possible to diagnose certain diseases, or in the case of this experiment cancer.<br>		Pictured here is an inside view of the Open Polymerase Chain Reaction (PCR) machine used to conduct the experiment. Open PCR works in a series of temperature controlled cycles that both heat and cool samples of DNA in order to duplicate certain segments of it. When the samples of DNA are heated or cooled to certain temperatures, primers and free-floating nucleotides in the DNA solution work to copy specific sequences of DNA. This is done so that the amplified DNA sequences make it possible to diagnose certain diseases, or in the case of this experiment cancer.<br>
-	[[Image:~~BME103_Group17_Assembly~~.png\|200px\|Image of the Open PCR]]	+	[[Image:PCR_Machine.png\|200px\|Image of the Open PCR]]

	'''Experimenting With the Connections'''<br>		'''Experimenting With the Connections'''<br>